Issue parsing bed file

[SeAudet]

At this point, I'm unsure what the tool expects, or what is wrong. From the READme I gathered it was not really tolerant to impure STR regions, so I made sure to extract only pure repeat expansion regions from hg38. Made sure they were detectable in the reference fasta (samtools faidx) and that some reads were present in the sorted BAM for the region (even some directly containing expansions). Made a tab-delimited bed in the format of the example data :
chr1 57367043 57367118 AAAAT
chr1 146228800 146228812 GCC
chr1 149390802 149390829 GGC
...

And yet, I keep facing the same issue :

I've tried buffering the input position (start & end; +1 & -1; also tried +2 at the end to match example of HTT) and I always receive the same message. The only thing that changes the output error is limiting the positions to 1 repeat (i.e. chr1 57367043 57367048 AAAAT instead of 57367118) however for all repeat it just outputs "ERROR! No reads were found for repeat region: chr1-57367043-57367048-AAAAT", even if reads are present (from the fact that it moves from step 1 to step 4 within 1 second I gather it probably doesn't actually check).

I also tried changing the nomenclature from chr1 -> 1 but unsurprisingly got "ValueError: invalid contig 1" since the reference used to align has the chr nomenclature. Command for reference (also tried with paths for minimap2/samtools but it doesn't seem to change anything) :
Running command: /opt/conda/bin/nanoRepeat.py -i /Path/Sample_sorted.bam -t bam -d ont_sup -r /Path/GRCh38.primary_assembly.genome.fa -b /Path/nano_pathogenic.hg38.bed -c 8 -o /Path/results/nanorepeat/01922-utm

Cheers,

[fangli80]

Hello,

I tested the same repeat region and nanorepeat was able to run correctly.

The hg38_pathogenic.bed file has three lines:

chr1	57367043	57367118	AAAAT
chr1	146228800	146228812	GCC
chr1	149390802	149390829	GGC

Were you using the latest version of NanoRepeat? You can use the following commands to install the latest version:

conda create -n nanorepeat python=3.8
conda activate nanorepeat
git clone https://github.com/WGLab/NanoRepeat.git
cd NanoRepeat
pip install .

[SeAudet]

Hello,

Thank you for the reply. I think I may have been using 1.8.1 or 1.8, so I re-installed via conda to make sure it wouldn't be the issue. The environment it creates is missing pysam, so I installed pysam-0.23.3 via pip. Then I ran the tool on my sample again. I still get the reference error for most regions :

ERROR! The given repeat motif (CAGA) was not found in the reference sequence (chr3:129172656-129172696). Please check your input!
The repeat motif is: CAGA
The sequence inside chr3:129172656-129172696 is: CAGACAGACAGACAGACAGACAGACAGACAGACAGACAGA

But for some repeats where there may be no expansion, we do "finish" :

[01/12/2026 14:12:38] NOTICE: [Process 04] Quantifying repeat: chr4-39348424-39348479-AAAAG
[01/12/2026 14:12:38] WARNING! No reads were found in repeat region: chr4-39348424-39348479-AAAAG
[01/12/2026 14:12:38] NOTICE: Program finished.

But at the end of the day, all output lines just look like the following :
chr1 57367043 57367118 AAAAT 0 -1 -1 Allele_Repeat_Size;Allele_Num_Support_Reads Read_Name;Read_Repeat_Size;Read_Allele_ID;PhasingConfidence

The bed I am using has more than 3 lines but has the same format, including your examples :

chr1	57367043	57367118	AAAAT
chr1	146228800	146228812	GCC
chr1	149390802	149390829	GGC
chr10	79826383	79826404	GGC

Cheers,

[fangli80]

git clone https://github.com/WGLab/NanoRepeat.git
cd NanoRepeat
pip install .

Please clone the latest version. I have changed the algorithm to detect motifs in ref seq. By the way, in this new version, I have added a new argument (--no_check_repeat_motif_in_ref). If you still have the issue, you can use --no_check_repeat_motif_in_ref to skip this step.

[fangli80]

You can also use pip install NanoRepeat==1.8.3 to install the latest version. Let me know if you still have this issue. Thanks.