diff --git a/.travis.yml b/.travis.yml index 693761b7f3..1899885529 100644 --- a/.travis.yml +++ b/.travis.yml @@ -65,9 +65,12 @@ matrix: - os: osx language: generic - osx_image: xcode7.3 + osx_image: xcode9 env: - TESTATTR="'not linux and not known_failing and not huge'" + - CC=cc + - CXX=c++ +# - c++=g++ before_install: - source ci_scripts/install.sh diff --git a/Makefile b/Makefile index c7a78807db..0bc0809209 100644 --- a/Makefile +++ b/Makefile @@ -131,7 +131,7 @@ clean: FORCE cd src/oxli && $(MAKE) clean || true cd tests && rm -rf khmertest_* || true rm -f pytests.xml - cd third-party/cqf && make clean || true + cd third-party/mqf && make clean || true rm -f $(EXTENSION_MODULE) rm -f khmer/*.pyc scripts/*.pyc tests/*.pyc oxli/*.pyc \ sandbox/*.pyc khmer/__pycache__/* sandbox/__pycache__/* \ diff --git a/examples/c++-api/Makefile b/examples/c++-api/Makefile index bbed2871ee..52784bc3ec 100644 --- a/examples/c++-api/Makefile +++ b/examples/c++-api/Makefile @@ -1,14 +1,20 @@ CXXFLAGS=--std=c++11 \ -I ../../include/ \ -I ../../third-party/smhasher \ - -I ../../third-party/cqf \ + -I ../../third-party/mqf \ -I ../../third-party/seqan/core/include/ \ -I ../../third-party/rollinghash TESTS=exact-counting bloom consume +ifneq ($(INCLUDE),) + INCLUDE := -I$(INCLUDE) +endif + +all: $(TESTS) + %: %.cc ../../src/oxli/liboxli.a - $(CXX) $(CXXFLAGS) $< ../../src/oxli/liboxli.a -o $@ + $(CXX) -undefined dynamic_lookup -arch x86_64 -lstdc++ -stdlib=libstdc++ -std=c++11 $(CXXFLAGS) $< ../../src/oxli/liboxli.a -o $@ ../../src/oxli/liboxli.a: cd ../../src/oxli && make @@ -18,7 +24,5 @@ run: all ./bloom ./consume reads.fastq -all: $(TESTS) - clean: -rm -f exact-counting bloom consume diff --git a/include/oxli/storage.hh b/include/oxli/storage.hh index 33fb6f7f73..86d5208bfd 100644 --- a/include/oxli/storage.hh +++ b/include/oxli/storage.hh @@ -44,7 +44,7 @@ Contact: khmer-project@idyll.org #include using MuxGuard = std::lock_guard; -#include "gqf.h" +#include "gqf.hh" namespace oxli { typedef std::unordered_map KmerCountMap; @@ -410,51 +410,78 @@ public: * * \brief A Quotient Filter storage */ - class QFStorage : public Storage { +class QFStorage : public Storage +{ protected: - QF cf; + QF mf; public: - QFStorage(int size) { - // size is the power of two to specify the number of slots in - // the filter (2**size). Third argument sets the number of bits used - // in the key (current value of size+8 is copied from the CQF example) - // Final argument is the number of bits allocated for the value, which - // we do not use. - qf_init(&cf, (1ULL << size), size+8, 0); - } - - ~QFStorage() { qf_destroy(&cf); } - - BoundedCounterType test_and_set_bits(HashIntoType khash) { - BoundedCounterType x = get_count(khash); - add(khash); - return !x; - } - - // - bool add(HashIntoType khash) { - bool is_new = get_count(khash) == 0; - qf_insert(&cf, khash % cf.range, 0, 1); - return is_new; - } - - // get the count for the given k-mer hash. - const BoundedCounterType get_count(HashIntoType khash) const { - return qf_count_key_value(&cf, khash % cf.range, 0); - } - - // Accessors for protected/private table info members - // xnslots is larger than nslots. It includes some extra slots to deal - // with some details of how the counting is implemented - std::vector get_tablesizes() const { return {cf.xnslots}; } - const size_t n_tables() const { return 1; } - const uint64_t n_unique_kmers() const { return cf.ndistinct_elts; } - const uint64_t n_occupied() const { return cf.noccupied_slots; } - void save(std::string outfilename, WordLength ksize); - void load(std::string infilename, WordLength &ksize); - - Byte **get_raw_tables() { return nullptr; } + QFStorage(int size) + { + // size is the power of two to specify the number of slots in + // the filter (2**size). Third argument sets the number of bits used + // in the key (current value of size+8 is copied from the CQF example) + // Final argument is the number of bits allocated for the value, which + // we do not use. + _supports_bigcount = true; + qf_init(&mf, (1ULL << size), size+8, 0,2,true,"",2038074761); + + + + } + + ~QFStorage() + { + qf_destroy(&mf); + } + + BoundedCounterType test_and_set_bits(HashIntoType khash) + { + BoundedCounterType x = get_count(khash); + add(khash); + return !x; + } + + // + bool add(HashIntoType khash) + { + bool is_new = get_count(khash) == 0; + qf_insert(&mf, khash % mf.metadata->range, 1,false,false); + return is_new; + } + + // get the count for the given k-mer hash. + const BoundedCounterType get_count(HashIntoType khash) const + { + return qf_count_key(&mf, khash % mf.metadata->range); + } + + // Accessors for protected/private table info members + // xnslots is larger than nslots. It includes some extra slots to deal + // with some details of how the counting is implemented + std::vector get_tablesizes() const + { + return {mf.metadata->xnslots}; + } + const size_t n_tables() const + { + return 1; + } + const uint64_t n_unique_kmers() const + { + return mf.metadata->ndistinct_elts; + } + const uint64_t n_occupied() const + { + return mf.metadata->noccupied_slots; + } + void save(std::string outfilename, WordLength ksize); + void load(std::string infilename, WordLength &ksize); + + Byte **get_raw_tables() + { + return nullptr; + } }; diff --git a/setup.cfg b/setup.cfg index 894a4ea9b8..18b56b6859 100644 --- a/setup.cfg +++ b/setup.cfg @@ -6,7 +6,7 @@ undef = NO_UNIQUE_RC # docker/Dockerfile # libraries = z,bz2 ## if using system libraries -include-dirs = include:third-party/zlib:third-party/bzip2:third-party/seqan/core/include:third-party/smhasher:third-party/cqf:third-party/rollinghash +include-dirs = include:third-party/zlib:third-party/bzip2:third-party/seqan/core/include:third-party/smhasher:third-party/rollinghash:third-party/mqf # include-dirs = lib ## if using system libraries (broken) diff --git a/setup.py b/setup.py index d4049347d3..b5c5cec38b 100755 --- a/setup.py +++ b/setup.py @@ -187,7 +187,7 @@ def build_dir(): # force 64bit only builds EXTRA_COMPILE_ARGS.extend(['-arch', 'x86_64', '-mmacosx-version-min=10.7', '-stdlib=libc++']) - EXTRA_LINK_ARGS.append('-mmacosx-version-min=10.7') + EXTRA_LINK_ARGS.extend(['-mmacosx-version-min=10.7', '-lstdc++']) if check_for_openmp(): EXTRA_COMPILE_ARGS.extend(['-fopenmp']) @@ -330,10 +330,10 @@ def run(self): if sys.platform == 'darwin' and 'gcov' in self.libraries: self.libraries.remove('gcov') - cqfcmd = ['bash', '-c', 'cd third-party/cqf && make'] - spawn(cmd=cqfcmd, dry_run=self.dry_run) + mqfcmd = ['bash', '-c', 'cd third-party/mqf && make'] + spawn(cmd=mqfcmd, dry_run=self.dry_run) for ext in self.extensions: - ext.extra_objects.append(path_join("third-party", "cqf", "gqf.o")) + ext.extra_objects.append(path_join("third-party", "mqf", "gqf.o")) if "z" not in self.libraries: zcmd = ['bash', '-c', 'cd ' + ZLIBDIR + ' && ( test Makefile -nt' diff --git a/src/oxli/Makefile b/src/oxli/Makefile index 9858659a6a..b7450e3126 100644 --- a/src/oxli/Makefile +++ b/src/oxli/Makefile @@ -69,8 +69,9 @@ PREFIX=/usr/local INCLUDES= -I ../../include/ -I ../../third-party/seqan/core/include/ \ -I ../../third-party/smhasher/ \ - -I ../../third-party/cqf/ \ - -I ../../third-party/rollinghash + -I ../../third-party/mqf/ \ + -I ../../third-party/rollinghash \ + ifeq ($(USE_SYSTEM_ZLIB), false) INCLUDES += -I ../../third-party/zlib/ @@ -102,6 +103,8 @@ CFLAGS += -Wshadow -Wcast-align -Wstrict-prototypes CFLAGS += $(INCLUDES) $(CPPFLAGS) LDFLAGS ?= +LDFLAGS += -lstdc++ + ifneq ($(USE_SYSTEM_ZLIB), false) LDFLAGS += -lz endif @@ -164,6 +167,8 @@ SONAME = liboxli.$(SHARED_EXT).$(LIB_VERSION) SONAME_FLAGS = -install_name $(PREFIX)/lib/$(SONAME) \ -compatibility_version $(LIB_VERSION) \ -current_version $(LIB_VERSION) +LDFLAGS += -stdlib=libstdc++ -std=c++11 -arch x86_64 +CXXFLAGS += -stdlib=libstdc++ -std=c++11 else SHARED_EXT = so SONAME = liboxli.$(SHARED_EXT).$(LIB_VERSION) @@ -221,10 +226,10 @@ BZIP2_OBJS_BASE= \ BZIP2_OBJS=$(addprefix $(BZIP2_DIR)/, $(BZIP2_OBJS_BASE)) # Counting bloom filter -CQF_DIR=../../third-party/cqf -CQF_OBJS_BASE= gqf.o +MQF_DIR=../../third-party/mqf +MQF_OBJS_BASE= gqf.o -CQF_OBJS=$(addprefix $(CQF_DIR)/, $(CQF_OBJS_BASE)) +MQF_OBJS=$(addprefix $(MQF_DIR)/, $(MQF_OBJS_BASE)) #### oxli proper below here #### @@ -259,9 +264,9 @@ PRECOMILE_OBJS += $(BZIP2_OBJS) PRECLEAN_TARGS += libbz2clean endif -LIBOXLI_OBJS += $(CQF_OBJS) -PRECOMILE_OBJS += $(CQF_OBJS) -PRECLEAN_TARGS += libcqfclean +LIBOXLI_OBJS += $(MQF_OBJS) +PRECOMILE_OBJS += $(MQF_OBJS) +PRECLEAN_TARGS += libmqfclean HEADERS= \ hashtable.hh \ @@ -290,8 +295,8 @@ zlibclean: (cd $(ZLIB_DIR) && make distclean) libbz2clean: (cd $(BZIP2_DIR) && make -f Makefile-libbz2_so clean) -libcqfclean: - (cd $(CQF_DIR) && make clean) +libmqfclean: + (cd $(MQF_DIR) && make clean) clean: $(PRECLEAN_TARGS) rm -f *.o *.a *.$(SHARED_EXT)* oxli.pc $(TEST_PROGS) @@ -315,8 +320,8 @@ $(ZLIB_OBJS): $(BZIP2_OBJS): (cd $(BZIP2_DIR) && make -f Makefile-libbz2_so $(BZIP2_OBJS_BASE)) -$(CQF_OBJS): - (cd $(CQF_DIR) && make) +$(MQF_OBJS): + (cd $(MQF_DIR) && make) # MurMur3 murmur3.o: ../../third-party/smhasher/MurmurHash3.cc @@ -326,7 +331,7 @@ murmur3.o: ../../third-party/smhasher/MurmurHash3.cc $(CXX) $(CXXFLAGS) $(LDFLAGS) -c -o $@ $< $(LIBOXLISO): $(LIBOXLI_OBJS) - $(CXX) $(CXXFLAGS) $(LDFLAGS) $(SONAME_FLAGS) -shared -o $@ $^ + clang++ $(CXXFLAGS) $(LDFLAGS) $(SONAME_FLAGS) -shared -o $@ $^ ln -sf $(SONAME) liboxli.$(SHARED_EXT) liboxli.a: $(LIBOXLI_OBJS) diff --git a/src/oxli/storage.cc b/src/oxli/storage.cc index 923843f451..cf20cfcf9e 100644 --- a/src/oxli/storage.cc +++ b/src/oxli/storage.cc @@ -923,34 +923,14 @@ void QFStorage::save(std::string outfilename, WordLength ksize) unsigned char version = SAVED_FORMAT_VERSION; unsigned char ht_type = SAVED_QFCOUNT; + outfile.write(SAVED_SIGNATURE, 4); outfile.write((const char *) &version, 1); outfile.write((const char *) &ht_type, 1); outfile.write((const char *) &ksize, sizeof(ksize)); - /* just a hack to handle __uint128_t value. Don't know a better to handle it - * right now */ - uint64_t tmp_range; - tmp_range = cf.range; - - outfile.write((const char *) &cf.nslots, sizeof(cf.nslots)); - outfile.write((const char *) &cf.xnslots, sizeof(cf.xnslots)); - outfile.write((const char *) &cf.key_bits, sizeof(cf.key_bits)); - outfile.write((const char *) &cf.value_bits, sizeof(cf.value_bits)); - outfile.write((const char *) &cf.key_remainder_bits, sizeof(cf.key_remainder_bits)); - outfile.write((const char *) &cf.bits_per_slot, sizeof(cf.bits_per_slot)); - outfile.write((const char *) &tmp_range, sizeof(tmp_range)); - outfile.write((const char *) &cf.nblocks, sizeof(cf.nblocks)); - outfile.write((const char *) &cf.nelts, sizeof(cf.nelts)); - outfile.write((const char *) &cf.ndistinct_elts, sizeof(cf.ndistinct_elts)); - outfile.write((const char *) &cf.noccupied_slots, sizeof(cf.noccupied_slots)); - - #if BITS_PER_SLOT == 8 || BITS_PER_SLOT == 16 || BITS_PER_SLOT == 32 || BITS_PER_SLOT == 64 - outfile.write((const char *) cf.blocks, sizeof(qfblock) * cf.nblocks); - #else - outfile.write((const char *) cf.blocks, - (sizeof(qfblock) + SLOTS_PER_BLOCK * cf.bits_per_slot / 8) * cf.nblocks); - #endif + outfile.write((const char *)mf.metadata,sizeof(qfmetadata)); + outfile.write((const char *)mf.blocks,mf.metadata->size); outfile.close(); } @@ -1011,34 +991,22 @@ void QFStorage::load(std::string infilename, WordLength &ksize) infile.read((char *) &save_ksize, sizeof(save_ksize)); ksize = save_ksize; - infile.read((char *) &cf.nslots, sizeof(cf.nslots)); - infile.read((char *) &cf.xnslots, sizeof(cf.xnslots)); - infile.read((char *) &cf.key_bits, sizeof(cf.key_bits)); - infile.read((char *) &cf.value_bits, sizeof(cf.value_bits)); - infile.read((char *) &cf.key_remainder_bits, sizeof(cf.key_remainder_bits)); - infile.read((char *) &cf.bits_per_slot, sizeof(cf.bits_per_slot)); - infile.read((char *) &tmp_range, sizeof(tmp_range)); - - infile.read((char *) &cf.nblocks, sizeof(cf.nblocks)); - infile.read((char *) &cf.nelts, sizeof(cf.nelts)); - infile.read((char *) &cf.ndistinct_elts, sizeof(cf.ndistinct_elts)); - infile.read((char *) &cf.noccupied_slots, sizeof(cf.noccupied_slots)); - /* just a hack to handle __uint128_t value. Don't know a better to handle it - * right now */ - cf.range = tmp_range; - // deallocate previously allocated blocks - free(cf.blocks); - /* allocate the space for the actual qf blocks */ - #if BITS_PER_SLOT == 8 || BITS_PER_SLOT == 16 || BITS_PER_SLOT == 32 || BITS_PER_SLOT == 64 - cf.blocks = (qfblock *)calloc(cf.nblocks, sizeof(qfblock)); - #else - cf.blocks = (qfblock *)calloc(cf.nblocks, sizeof(qfblock) + SLOTS_PER_BLOCK * cf.bits_per_slot / 8); - #endif - #if BITS_PER_SLOT == 8 || BITS_PER_SLOT == 16 || BITS_PER_SLOT == 32 || BITS_PER_SLOT == 64 - infile.read((char *) cf.blocks, sizeof(qfblock) * cf.nblocks); - #else - infile.read((char *) cf.blocks, - (sizeof(qfblock) + SLOTS_PER_BLOCK * cf.bits_per_slot / 8) * cf.nblocks); - #endif + mf.mem = (qfmem *)calloc(sizeof(qfmem), 1); + mf.metadata = (qfmetadata *)calloc(sizeof(qfmetadata), 1); + infile.read((char*)mf.metadata,sizeof(qfmetadata)); + mf.blocks = (qfblock *)calloc(mf.metadata->size, 1); + infile.read((char*)mf.blocks, mf.metadata->size); + + mf.metadata->num_locks = + 10;//should be changed to something realistic like function qf_deserialize + mf.mem->metadata_lock = 0; + /* initialize all the locks to 0 */ + mf.mem->locks = (volatile int *)calloc(mf.metadata->num_locks, + sizeof(volatile int)); + + + + + infile.close(); } diff --git a/tests/test_qfstorage.py b/tests/test_qfstorage.py index d12d058e08..4c1eae80f0 100755 --- a/tests/test_qfstorage.py +++ b/tests/test_qfstorage.py @@ -2,26 +2,137 @@ import random from khmer import QFCounttable +import khmer +from tests import khmer_tst_utils as utils +from khmer import ReadParser -from . import khmer_tst_utils as utils +import random +import pytest -def test_read_write(): - rng = random.Random(1) +MAX_COUNT = 255 +MAX_BIGCOUNT = 65535 + +sketchSize = 1048576 + + +DNA = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC" + + +def teardown(): + utils.cleanup() + + +@pytest.fixture(params=[khmer.QFCounttable]) +def getSketch(request): + return request.param + + +def test_count_1(getSketch): + print("start") + hi = getSketch(12, sketchSize) + + kmer = 'G' * 12 + hashval = hi.hash('G' * 12) + + assert hi.get(kmer) == 0 + assert hi.get(hashval) == 0 + + hi.count(kmer) + assert hi.get(kmer) == 1 + assert hi.get(hashval) == 1 + + hi.count(kmer) + assert hi.get(kmer) == 2 + assert hi.get(hashval) == 2 + + kmer = 'G' * 11 + + with pytest.raises(ValueError): + hi.hash(kmer) - qf = QFCounttable(20, 1024 * 4) + +def test_count_2(getSketch): + hi = getSketch(12, sketchSize) + print("done") + kmer = 'G' * 12 + hashval = hi.hash('G' * 12) + + assert hi.get(kmer) == 0 + assert hi.get(hashval) == 0 + + hi.count(kmer) + assert hi.get(kmer) == 1 + assert hi.get(hashval) == 1 + + hi.count(hashval) # count hashes same as strings + assert hi.get(kmer) == 2 + assert hi.get(hashval) == 2 + + +def test_read_write(getSketch): + print("Start") + fname = str.encode(utils.get_temp_filename('zzz')) + rng = random.Random(1) + ctm = getSketch(20, sketchSize) kmers = ["".join(rng.choice("ACGT") for _ in range(20)) for n in range(400)] for kmer in kmers: - qf.add(kmer) + ctm.add(kmer) - fname = utils.get_temp_filename('zzz') + ctm.save(fname) - qf.save(fname) + # print("Finish") + # # on purpose choose parameters that are different from sct + ctm2 = getSketch.load(fname) + ctm2.load(fname) + # assert ctm.ksize() == ctm2.ksize() + # for kmer in kmers: + # assert ctm.get(kmer) == ctm2.get(kmer) + # + # - # on purpose choose parameters that are different from sct - qf2 = QFCounttable.load(fname) - assert qf.ksize() == qf2.ksize() - for kmer in kmers: - assert qf.get(kmer) == qf2.get(kmer) + +def test_maxcount_with_bigcount(getSketch): + # hashtable should not saturate, if use_bigcount is set. + kh = getSketch(4, 128) + + last_count = None + for _ in range(0, 10000): + kh.count('AAAA') + c = kh.get('AAAA') + print(c) + if c == last_count: + break + + last_count = c + + assert c == 10000, "should be able to count to 1000: %d" % c + + +def test_get_ksize(getSketch): + kh = getSketch(22, 16) + assert kh.ksize() == 22 + + +# +# def test_read_write(): +# rng = random.Random(1) +# +# qf = QFCounttable(20, 1024 * 4) +# +# kmers = ["".join(rng.choice("ACGT") for _ in range(20)) +# for n in range(400)] +# for kmer in kmers: +# qf.add(kmer) +# +# fname = utils.get_temp_filename('zzz') +# +# qf.save(fname) +# +# # on purpose choose parameters that are different from sct +# qf2 = QFCounttable.load(fname) +# assert qf.ksize() == qf2.ksize() +# for kmer in kmers: +# assert qf.get(kmer) == qf2.get(kmer) diff --git a/tests/test_tabletype.py b/tests/test_tabletype.py index f92058ca51..106a1146eb 100755 --- a/tests/test_tabletype.py +++ b/tests/test_tabletype.py @@ -77,12 +77,14 @@ def test_n_occupied(AnyTabletype): assert tt.n_unique_kmers() == 1 tt.add(kmer) + assert tt.n_occupied() == 1 # the CQF implementation we use can use more than one slot to represent # counts for a single kmer - if not tt.__class__.__name__.startswith("QF"): - assert tt.n_occupied() == 1 - else: - assert tt.n_occupied() == 2 + # if not tt.__class__.__name__.startswith("QF"): + # assert tt.n_occupied() == 1 + # else: + # assert tt.n_occupied() == 2 + assert tt.n_unique_kmers() == 1 diff --git a/third-party/cqf/gqf.h b/third-party/cqf/gqf.h deleted file mode 100644 index ef8b5c4b32..0000000000 --- a/third-party/cqf/gqf.h +++ /dev/null @@ -1,160 +0,0 @@ -/* - * ===================================================================================== - * - * Filename: gqf.h - * - * Description: - * - * Version: 1.0 - * Created: 2017-02-04 03:40:58 PM - * Revision: none - * Compiler: gcc - * - * Author: Prashant Pandey (ppandey@cs.stonybrook.edu) - * Rob Johnson (rob@cs.stonybrook.edu) - * Organization: Stony Brook University - * - * ===================================================================================== - */ - -#ifndef QF_H -#define QF_H - -#include - -#ifdef __cplusplus -extern "C" { -#endif - -#define BITS_PER_SLOT 8 - -/* Must be >= 6. 6 seems fastest. */ -#define BLOCK_OFFSET_BITS (6) - -#define SLOTS_PER_BLOCK (1ULL << BLOCK_OFFSET_BITS) -#define METADATA_WORDS_PER_BLOCK ((SLOTS_PER_BLOCK + 63) / 64) - - typedef struct __attribute__ ((__packed__)) qfblock { - uint8_t offset; /* Code works with uint16_t, uint32_t, etc, but uint8_t seems just as fast as anything else */ - uint64_t occupieds[METADATA_WORDS_PER_BLOCK]; - uint64_t runends[METADATA_WORDS_PER_BLOCK]; - - #if BITS_PER_SLOT == 8 - uint8_t slots[SLOTS_PER_BLOCK]; - #elif BITS_PER_SLOT == 16 - uint16_t slots[SLOTS_PER_BLOCK]; - #elif BITS_PER_SLOT == 32 - uint32_t slots[SLOTS_PER_BLOCK]; - #elif BITS_PER_SLOT == 64 - uint64_t slots[SLOTS_PER_BLOCK]; - #elif BITS_PER_SLOT != 0 - uint8_t slots[SLOTS_PER_BLOCK * BITS_PER_SLOT / 8]; - #else - uint8_t slots[]; - #endif - } qfblock; - - uint64_t shift_into_b2(uint64_t a, uint64_t b, int bstart, int bend, int amount); - -#ifdef LOG_NUM_SHIFTS -#define len 5000 -int shift_count[len]; -#endif - - typedef struct quotient_filter { - uint64_t nslots; - uint64_t xnslots; - uint64_t key_bits; - uint64_t value_bits; - uint64_t key_remainder_bits; - uint64_t bits_per_slot; - __uint128_t range; - uint64_t nblocks; - uint64_t nelts; - uint64_t ndistinct_elts; - uint64_t noccupied_slots; - qfblock *blocks; - } quotient_filter; - - - typedef quotient_filter QF; - - typedef struct quotient_filter_iterator { - const QF *qf; - uint64_t run; - uint64_t current; - } quotient_filter_iterator; - - typedef quotient_filter_iterator QFi; - - void qf_init(QF *qf, uint64_t nslots, uint64_t key_bits, uint64_t value_bits); - - void qf_destroy(QF *qf); - - /* Increment the counter for this key/value pair by count. */ - void qf_insert(QF *qf, uint64_t key, uint64_t value, uint64_t count); - - /* Remove count instances of this key/value combination. */ - void qf_remove(QF *qf, uint64_t key, uint64_t value, uint64_t count); - - /* Remove all instances of this key/value pair. */ - void qf_delete_key_value(QF *qf, uint64_t key, uint64_t value); - - /* Remove all instances of this key. */ - void qf_delete_key(QF *qf, uint64_t key); - - /* Replace the association (key, oldvalue, count) with the association - (key, newvalue, count). If there is already an association (key, - newvalue, count'), then the two associations will be merged and - their counters will be summed, resulting in association (key, - newvalue, count' + count). */ - void qf_replace(QF *qf, uint64_t key, uint64_t oldvalue, uint64_t newvalue); - - /* Lookup the value associated with key. Returns the count of that - key/value pair in the QF. If it returns 0, then, the key is not - present in the QF. Only returns the first value associated with key - in the QF. If you want to see others, use an iterator. */ - uint64_t qf_query(const QF *qf, uint64_t key, uint64_t *value); - - /* Return the number of times key has been inserted, with any value, - into qf. */ - uint64_t qf_count_key(const QF *qf, uint64_t key); - - /* Return the number of times key has been inserted, with the given - value, into qf. */ - uint64_t qf_count_key_value(const QF *qf, uint64_t key, uint64_t value); - - /* Initialize an iterator */ - void qf_iterator(const QF *qf, QFi *qfi, uint64_t position); - - /* Returns 0 if the iterator is still valid (i.e. has not reached the - end of the QF. */ - int qfi_get(QFi *qfi, uint64_t *key, uint64_t *value, uint64_t *count); - - /* Advance to next entry. Returns whether or not another entry is - found. */ - int qfi_next(QFi *qfi); - - /* Check to see if the if the end of the QF */ - int qfi_end(QFi *qfi); - - /* For debugging */ - void qf_dump(const QF *); - - /* write data structure of to the disk */ - void qf_serialize(const QF *qf, const char *filename); - - /* read data structure off the disk */ - void qf_deserialize(QF *qf, const char *filename); - - /* merge two QFs into the third one. */ - void qf_merge(const QF *qfa, const QF *qfb, QF *qfc); - - /* merge multiple QFs into the final QF one. */ - void qf_multi_merge(QF *qf_arr[], int nqf, QF *qfr); - -#ifdef __cplusplus -} -#endif - -#endif /* QF_H */ diff --git a/third-party/mqf/LICENSE b/third-party/mqf/LICENSE new file mode 100644 index 0000000000..09d493bf1f --- /dev/null +++ b/third-party/mqf/LICENSE @@ -0,0 +1,29 @@ +BSD 3-Clause License + +Copyright (c) 2017, +All rights reserved. + +Redistribution and use in source and binary forms, with or without +modification, are permitted provided that the following conditions are met: + +* Redistributions of source code must retain the above copyright notice, this + list of conditions and the following disclaimer. + +* Redistributions in binary form must reproduce the above copyright notice, + this list of conditions and the following disclaimer in the documentation + and/or other materials provided with the distribution. + +* Neither the name of the copyright holder nor the names of its + contributors may be used to endorse or promote products derived from + this software without specific prior written permission. + +THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" +AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE +IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE +DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT HOLDER OR CONTRIBUTORS BE LIABLE +FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL +DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR +SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER +CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, +OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE +OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. diff --git a/third-party/mqf/Makefile b/third-party/mqf/Makefile new file mode 100644 index 0000000000..2e463fb0e7 --- /dev/null +++ b/third-party/mqf/Makefile @@ -0,0 +1,62 @@ +TARGETS=gqf.o + +ifdef D + DEBUG=-g + OPT= +else + DEBUG= + OPT=-Ofast +endif + +# using the SSE4.2 extensions doesn't seem to speed things up by a large +# amount, so disabling it for the time being till we have a good automated +# test for detecting whether or not the CPU supports it +OS := $(shell uname) +ifeq ($(OS), Darwin) + ARCH=-m64 +else + #ARCH=-msse4.2 -D__SSE4_2_ + ARCH= +endif + +ifdef P + PROFILE=-pg -no-pie # for bug in gprof. +endif + +ifneq ($(INCLUDE),) + INCLUDE := -I$(INCLUDE) +endif + +CXX = g++ +CC = g++ +LD= g++ + +CXXFLAGS = -std=c++11 -lstdc++ -stdlib=libstdc++ -arch x86_64 -fPIC $(ARCH) -Wall $(DEBUG) $(PROFILE) $(OPT) -I. -Wno-unused-result -Wno-strict-aliasing -Wno-unused-function + + +LDFLAGS = $(DEBUG) $(PROFILE) $(OPT) + +# +# declaration of dependencies +# + +all: $(TARGETS) + +# dependencies between programs and .o files + + + +# dependencies between .o files and .cc (or .c) files + +%.o: %.cc +gqf.o: gqf.cc gqf.hh + +# +# generic build rules +# + +%.o: %.cc + $(CXX) $(CXXFLAGS) $(INCLUDE) $< -c -o $@ + +clean: + rm -f *.o $(TARGETS) diff --git a/third-party/mqf/README.md b/third-party/mqf/README.md new file mode 100644 index 0000000000..6a50a694da --- /dev/null +++ b/third-party/mqf/README.md @@ -0,0 +1,109 @@ +# MQF +[![Build Status](https://travis-ci.org/shokrof/MQF.svg?branch=mqfDevelopmenet)](https://travis-ci.org/shokrof/MQF) +[![codecov](https://codecov.io/gh/shokrof/MQF/branch/mqfDevelopmenet/graph/badge.svg)](https://codecov.io/gh/shokrof/MQF) + +MQF, Mixed Quotient Filter, is approximate membership query data structure that supports many useful functions. MQF is a variant of [CQF](https://github.com/splatlab/cqf). MQF has lower bits per element than Bloom filter and Count-min sketches. MQF also has good data locality which makes it efficient when running on secondary storage. Moreover. It supports removing, iterating, merging ,and resizing. + +## Documentation +### Building +MQF onlye requires make and g++ to be installed. +```bash +apt-get install make g++ +make NH=1 +make test NH=1 +./mqf_test +``` +### Initialization +1. qf_init +2. qf_destroy +3. estimate + +### Functions Supported +1. Insert : +Increment the counter for this item by count. + ```c++ + bool qf_insert(QF *qf, uint64_t key, + uint64_t count,bool lock, bool spin); + ``` + + * Qf* qf : pointer to the Filter + * uint64_t key : hash of the item to be inserted. + * uint64_t count: Count to be added + * bool lock: For Multithreading, Lock the * slot used by the current thread so that other threads can't change the value + * bool spin: For Multithreading, If there is a lock on the target slot. wait until the lock is freed and insert the count. + * returns True if the insertion succeeded. + +2. Count: + Return the number of times key has been inserted, with any value, into qf. + ```c++ + uint64_t qf_count_key(const QF *qf, uint64_t key); + ``` + * Qf* qf : pointer to the Filter + * uint64_t key : hash of the item to be counted. + * returns the number of times the item is inserted. +3. Remove: +Decrement the counter for this item by count. +```c++ +bool qf_remove(QF *qf, uint64_t hash, uint64_t count, bool lock, bool spin); +``` + * Qf* qf : pointer to the Filter + * uint64_t key : hash of the item to be removed + * uint64_t count: Count to be removed + * bool lock: For Multithreading, Lock the slot used by the current thread so that other threads can't change the value + * bool spin: For Multithreading, If there is a lock on the target slot. wait until the lock is freed and insert the count. + +4. Add/Remove tag to elements +```c++ +uint64_t qf_add_tag(const QF *qf, uint64_t key, uint64_t tag, bool lock, bool spin); +uint64_t qf_get_tag(const QF *qf, uint64_t key); +uint64_t qf_remove_tag(const QF *qf, uint64_t key, bool lock, bool spin); +``` + * Qf* qf : pointer to the Filter + * uint64_t key : hash of the item. + * uint64_t tag: tag for the item. + * bool lock: For Multithreading, Lock the slot used by the current thread so that other threads can't change the value + * bool spin: For Multithreading, If there is a lock on the target slot. wait until the lock is freed and insert the count. + +5. Resize: + resize the filter into a bigger or smaller one + ```c++ + QF* qf_resize(QF* qf, int newQ, const char * originalFilename=NULL, const char * newFilename=NULL); + ``` + * Qf* qf : pointer to the Filter + * uint64_t newQ: new number of slots(Q). the slot size will be recalculated to keep the range constant. + * string originalFilename(optional): dump the current filter to the disk to free space for the new filter. Filename is provided as the content of the string. + * string newFilename(optional): the new filter is created on disk. Filename is provided as the content of the string. + * returns a pointer to the new filter + +6. Merge: merge more than one filter into a final one. +```c++ +void qf_merge(QF *qfa, QF *qfb, QF *qfc); +void qf_multi_merge(QF *qf_arr[], int nqf, QF *qfr); +``` + +7. Compare: +check if two filters have the same items, counts and tags. +```c++ +bool qf_equals(QF *qfa, QF *qfb); +``` +8. Intersect +calculate the the intersection between two filters. +```c++ +void qf_intersect(QF *qfa, QF *qfb, QF *qfc); +``` +9. Subtract +subtract the second filter from the first. +```c++ +void qf_subtract(QF *qfa, QF *qfb, QF *qfc); +``` +10. Space: +returns the space percent occupied by the inserted items. +```c++ +int qf_space(QF *qf); +``` + +### Miscellaneous Functions +1. Capacity +2. Copy +3. Serialize/ Deserialize +4. MMap read diff --git a/third-party/mqf/gqf.cc b/third-party/mqf/gqf.cc new file mode 100644 index 0000000000..719e5c22e7 --- /dev/null +++ b/third-party/mqf/gqf.cc @@ -0,0 +1,2701 @@ +#include +#if 0 +# include +#else +# define assert(x) +#endif +#include +#include +#include +#include +#include +#include +#include +#include +#include +#include +#include +#include +#include "gqf.hh" +#include + +// extern "C" { + + /****************************************************************** + * Code for managing the metadata bits and slots w/o interpreting * + * the content of the slots. + ******************************************************************/ + +/* Must be >= 6. 6 seems fastest. */ +#define BLOCK_OFFSET_BITS (6) + +#define SLOTS_PER_BLOCK (1ULL << BLOCK_OFFSET_BITS) +#define METADATA_WORDS_PER_BLOCK ((SLOTS_PER_BLOCK + 63) / 64) + +#define NUM_SLOTS_TO_LOCK (1ULL<<16) +#define CLUSTER_SIZE (1ULL<<14) + +#define METADATA_WORD(qf,field,slot_index) (get_block((qf), (slot_index) / \ + SLOTS_PER_BLOCK)->field[((slot_index) % SLOTS_PER_BLOCK) / 64]) + +#define BITMASK(nbits) ((nbits) == 64 ? 0xffffffffffffffff : (1ULL << (nbits)) \ + - 1ULL) +#define MAX_VALUE(nbits) ((1ULL << (nbits)) - 1) +#define BILLION 1000000000L + +typedef struct __attribute__ ((__packed__)) qfblock { + /* Code works with uint16_t, uint32_t, etc, but uint8_t seems just as fast as + * anything else */ + uint8_t offset; + uint64_t occupieds[METADATA_WORDS_PER_BLOCK]; + uint64_t runends[METADATA_WORDS_PER_BLOCK]; +#if BITS_PER_SLOT == 8 + uint8_t slots[SLOTS_PER_BLOCK]; +#elif BITS_PER_SLOT == 16 + uint16_t slots[SLOTS_PER_BLOCK]; +#elif BITS_PER_SLOT == 32 + uint32_t slots[SLOTS_PER_BLOCK]; +#elif BITS_PER_SLOT == 64 + uint64_t slots[SLOTS_PER_BLOCK]; +#elif BITS_PER_SLOT != 0 + uint8_t slots[SLOTS_PER_BLOCK * BITS_PER_SLOT / 8]; +#else + uint8_t slots[]; +#endif +} qfblock; + +static __inline__ unsigned long long rdtsc(void) +{ + unsigned hi, lo; + __asm__ __volatile__ ("rdtsc" : "=a"(lo), "=d"(hi)); + return ( (unsigned long long)lo)|( ((unsigned long long)hi)<<32 ); +} + +#ifdef LOG_WAIT_TIME +static inline bool qf_spin_lock(QF *cf, volatile int *lock, uint64_t idx, bool + flag_spin) +{ + struct timespec start, end; + bool ret; + + clock_gettime(CLOCK_THREAD_CPUTIME_ID, &start); + if (!flag_spin) { + ret = !__sync_lock_test_and_set(lock, 1); + clock_gettime(CLOCK_THREAD_CPUTIME_ID, &end); + cf->mem->wait_times[idx].locks_acquired_single_attempt++; + cf->mem->wait_times[idx].total_time_single += BILLION * (end.tv_sec - + start.tv_sec) + + end.tv_nsec - start.tv_nsec; + } else { + if (!__sync_lock_test_and_set(lock, 1)) { + clock_gettime(CLOCK_THREAD_CPUTIME_ID, &end); + cf->mem->wait_times[idx].locks_acquired_single_attempt++; + cf->mem->wait_times[idx].total_time_single += BILLION * (end.tv_sec - + start.tv_sec) + + end.tv_nsec - start.tv_nsec; + } else { + while (__sync_lock_test_and_set(lock, 1)) + while (*lock); + clock_gettime(CLOCK_THREAD_CPUTIME_ID, &end); + cf->mem->wait_times[idx].total_time_spinning += BILLION * (end.tv_sec - + start.tv_sec) + + end.tv_nsec - start.tv_nsec; + } + ret = true; + } + cf->mem->wait_times[idx].locks_taken++; + + return ret; + + /*start = rdtsc();*/ + /*if (!__sync_lock_test_and_set(lock, 1)) {*/ + /*clock_gettime(CLOCK_THREAD_CPUTIME_ID, &end);*/ + /*cf->mem->wait_times[idx].locks_acquired_single_attempt++;*/ + /*cf->mem->wait_times[idx].total_time_single += BILLION * (end.tv_sec - + * start.tv_sec) + end.tv_nsec - start.tv_nsec;*/ + /*} else {*/ + /*while (__sync_lock_test_and_set(lock, 1))*/ + /*while (*lock);*/ + /*clock_gettime(CLOCK_THREAD_CPUTIME_ID, &end);*/ + /*cf->mem->wait_times[idx].total_time_spinning += BILLION * (end.tv_sec - + * start.tv_sec) + end.tv_nsec - start.tv_nsec;*/ + /*}*/ + + /*end = rdtsc();*/ + /*cf->mem->wait_times[idx].locks_taken++;*/ + /*return;*/ +} +#else +/** + * Try to acquire a lock once and return even if the lock is busy. + * If spin flag is set, then spin until the lock is available. + */ +static inline bool qf_spin_lock(volatile int *lock, bool flag_spin) +{ + if (!flag_spin) { + return !__sync_lock_test_and_set(lock, 1); + } else { + while (__sync_lock_test_and_set(lock, 1)) + while (*lock); + return true; + } + + return false; +} +#endif + +static inline void qf_spin_unlock(volatile int *lock) +{ + __sync_lock_release(lock); + return; +} + +static bool qf_lock(const QF *cf, uint64_t hash_bucket_index, bool spin, bool flag) +{ + uint64_t hash_bucket_lock_offset = hash_bucket_index % NUM_SLOTS_TO_LOCK; + if (flag) { +#ifdef LOG_WAIT_TIME + if (!qf_spin_lock(cf, &cf->mem->locks[hash_bucket_index/NUM_SLOTS_TO_LOCK], + hash_bucket_index/NUM_SLOTS_TO_LOCK, spin)) + return false; + if (NUM_SLOTS_TO_LOCK - hash_bucket_lock_offset <= CLUSTER_SIZE) { + if (!qf_spin_lock(cf, &cf->mem->locks[hash_bucket_index/NUM_SLOTS_TO_LOCK+1], + hash_bucket_index/NUM_SLOTS_TO_LOCK+1, spin)) { + qf_spin_unlock(&cf->mem->locks[hash_bucket_index/NUM_SLOTS_TO_LOCK]); + return false; + } + } +#else + if (!qf_spin_lock(&cf->mem->locks[hash_bucket_index/NUM_SLOTS_TO_LOCK], spin)) + return false; + if (NUM_SLOTS_TO_LOCK - hash_bucket_lock_offset <= CLUSTER_SIZE) { + if (!qf_spin_lock(&cf->mem->locks[hash_bucket_index/NUM_SLOTS_TO_LOCK+1], + spin)) { + qf_spin_unlock(&cf->mem->locks[hash_bucket_index/NUM_SLOTS_TO_LOCK]); + return false; + } + } +#endif + } else { + /* take the lock for two lock-blocks; the lock-block in which the + * hash_bucket_index falls and the next lock-block */ + +#ifdef LOG_WAIT_TIME + if (hash_bucket_index >= NUM_SLOTS_TO_LOCK && hash_bucket_lock_offset <= + CLUSTER_SIZE) { + if (!qf_spin_lock(cf, &cf->mem->locks[hash_bucket_index/NUM_SLOTS_TO_LOCK-1], spin)) + return false; + } + if (!qf_spin_lock(cf, &cf->mem->locks[hash_bucket_index/NUM_SLOTS_TO_LOCK], spin)) { + if (hash_bucket_index >= NUM_SLOTS_TO_LOCK && hash_bucket_lock_offset <= + CLUSTER_SIZE) + qf_spin_unlock(&cf->mem->locks[hash_bucket_index/NUM_SLOTS_TO_LOCK-1]); + return false; + } + if (!qf_spin_lock(cf, &cf->mem->locks[hash_bucket_index/NUM_SLOTS_TO_LOCK+1], + spin)) { + qf_spin_unlock(&cf->mem->locks[hash_bucket_index/NUM_SLOTS_TO_LOCK]); + if (hash_bucket_index >= NUM_SLOTS_TO_LOCK && hash_bucket_lock_offset <= + CLUSTER_SIZE) + qf_spin_unlock(&cf->mem->locks[hash_bucket_index/NUM_SLOTS_TO_LOCK-1]); + return false; + } +#else + if (hash_bucket_index >= NUM_SLOTS_TO_LOCK && hash_bucket_lock_offset <= + CLUSTER_SIZE) { + if (!qf_spin_lock(&cf->mem->locks[hash_bucket_index/NUM_SLOTS_TO_LOCK-1], spin)) + return false; + } + if (!qf_spin_lock(&cf->mem->locks[hash_bucket_index/NUM_SLOTS_TO_LOCK], spin)) { + if (hash_bucket_index >= NUM_SLOTS_TO_LOCK && hash_bucket_lock_offset <= + CLUSTER_SIZE) + qf_spin_unlock(&cf->mem->locks[hash_bucket_index/NUM_SLOTS_TO_LOCK-1]); + return false; + } + if (!qf_spin_lock(&cf->mem->locks[hash_bucket_index/NUM_SLOTS_TO_LOCK+1], + spin)) { + qf_spin_unlock(&cf->mem->locks[hash_bucket_index/NUM_SLOTS_TO_LOCK]); + if (hash_bucket_index >= NUM_SLOTS_TO_LOCK && hash_bucket_lock_offset <= + CLUSTER_SIZE) + qf_spin_unlock(&cf->mem->locks[hash_bucket_index/NUM_SLOTS_TO_LOCK-1]); + return false; + } +#endif + } + return true; +} + +static void qf_unlock(const QF *cf, uint64_t hash_bucket_index, bool flag) +{ + uint64_t hash_bucket_lock_offset = hash_bucket_index % NUM_SLOTS_TO_LOCK; + if (flag) { + if (NUM_SLOTS_TO_LOCK - hash_bucket_lock_offset <= CLUSTER_SIZE) { + qf_spin_unlock(&cf->mem->locks[hash_bucket_index/NUM_SLOTS_TO_LOCK+1]); + } + qf_spin_unlock(&cf->mem->locks[hash_bucket_index/NUM_SLOTS_TO_LOCK]); + } else { + qf_spin_unlock(&cf->mem->locks[hash_bucket_index/NUM_SLOTS_TO_LOCK+1]); + qf_spin_unlock(&cf->mem->locks[hash_bucket_index/NUM_SLOTS_TO_LOCK]); + if (hash_bucket_index >= NUM_SLOTS_TO_LOCK && hash_bucket_lock_offset <= + CLUSTER_SIZE) + qf_spin_unlock(&cf->mem->locks[hash_bucket_index/NUM_SLOTS_TO_LOCK-1]); + } +} + +static void modify_metadata(QF *cf, uint64_t *metadata, int cnt) +{ +#ifdef LOG_WAIT_TIME + qf_spin_lock(cf, &cf->mem->metadata_lock,cf->num_locks, true); +#else + qf_spin_lock(&cf->mem->metadata_lock, true); +#endif + *metadata = *metadata + cnt; + qf_spin_unlock(&cf->mem->metadata_lock); + return; +} + +static inline int popcnt(uint64_t val) +{ + asm("popcnt %[val], %[val]" + : [val] "+r" (val) + : + : "cc"); + return val; +} + +static inline int64_t bitscanreverse(uint64_t val) +{ + if (val == 0) { + return -1; + } else { + asm("bsr %[val], %[val]" + : [val] "+r" (val) + : + : "cc"); + return val; + } +} + +static inline int popcntv(const uint64_t val, int ignore) +{ + if (ignore % 64) + return popcnt (val & ~BITMASK(ignore % 64)); + else + return popcnt(val); +} + +// Returns the number of 1s up to (and including) the pos'th bit +// Bits are numbered from 0 +static inline int bitrank(uint64_t val, int pos) { + val = val & ((2ULL << pos) - 1); + asm("popcnt %[val], %[val]" + : [val] "+r" (val) + : + : "cc"); + return val; +} + +/** + * Returns the position of the k-th 1 in the 64-bit word x. + * k is 0-based, so k=0 returns the position of the first 1. + * + * Uses the broadword selection algorithm by Vigna [1], improved by Gog + * and Petri [2] and Vigna [3]. + * + * [1] Sebastiano Vigna. Broadword Implementation of Rank/Select + * Queries. WEA, 2008 + * + * [2] Simon Gog, Matthias Petri. Optimized succinct data + * structures for massive data. Softw. Pract. Exper., 2014 + * + * [3] Sebastiano Vigna. MG4J 5.2.1. http://mg4j.di.unimi.it/ + * The following code is taken from + * https://github.com/facebook/folly/blob/b28186247104f8b90cfbe094d289c91f9e413317/folly/experimental/Select64.h + */ +const uint8_t kSelectInByte[2048] = { + 8, 0, 1, 0, 2, 0, 1, 0, 3, 0, 1, 0, 2, 0, 1, 0, 4, 0, 1, 0, 2, 0, 1, 0, 3, 0, + 1, 0, 2, 0, 1, 0, 5, 0, 1, 0, 2, 0, 1, 0, 3, 0, 1, 0, 2, 0, 1, 0, 4, 0, 1, 0, + 2, 0, 1, 0, 3, 0, 1, 0, 2, 0, 1, 0, 6, 0, 1, 0, 2, 0, 1, 0, 3, 0, 1, 0, 2, 0, + 1, 0, 4, 0, 1, 0, 2, 0, 1, 0, 3, 0, 1, 0, 2, 0, 1, 0, 5, 0, 1, 0, 2, 0, 1, 0, + 3, 0, 1, 0, 2, 0, 1, 0, 4, 0, 1, 0, 2, 0, 1, 0, 3, 0, 1, 0, 2, 0, 1, 0, 7, 0, + 1, 0, 2, 0, 1, 0, 3, 0, 1, 0, 2, 0, 1, 0, 4, 0, 1, 0, 2, 0, 1, 0, 3, 0, 1, 0, + 2, 0, 1, 0, 5, 0, 1, 0, 2, 0, 1, 0, 3, 0, 1, 0, 2, 0, 1, 0, 4, 0, 1, 0, 2, 0, + 1, 0, 3, 0, 1, 0, 2, 0, 1, 0, 6, 0, 1, 0, 2, 0, 1, 0, 3, 0, 1, 0, 2, 0, 1, 0, + 4, 0, 1, 0, 2, 0, 1, 0, 3, 0, 1, 0, 2, 0, 1, 0, 5, 0, 1, 0, 2, 0, 1, 0, 3, 0, + 1, 0, 2, 0, 1, 0, 4, 0, 1, 0, 2, 0, 1, 0, 3, 0, 1, 0, 2, 0, 1, 0, 8, 8, 8, 1, + 8, 2, 2, 1, 8, 3, 3, 1, 3, 2, 2, 1, 8, 4, 4, 1, 4, 2, 2, 1, 4, 3, 3, 1, 3, 2, + 2, 1, 8, 5, 5, 1, 5, 2, 2, 1, 5, 3, 3, 1, 3, 2, 2, 1, 5, 4, 4, 1, 4, 2, 2, 1, + 4, 3, 3, 1, 3, 2, 2, 1, 8, 6, 6, 1, 6, 2, 2, 1, 6, 3, 3, 1, 3, 2, 2, 1, 6, 4, + 4, 1, 4, 2, 2, 1, 4, 3, 3, 1, 3, 2, 2, 1, 6, 5, 5, 1, 5, 2, 2, 1, 5, 3, 3, 1, + 3, 2, 2, 1, 5, 4, 4, 1, 4, 2, 2, 1, 4, 3, 3, 1, 3, 2, 2, 1, 8, 7, 7, 1, 7, 2, + 2, 1, 7, 3, 3, 1, 3, 2, 2, 1, 7, 4, 4, 1, 4, 2, 2, 1, 4, 3, 3, 1, 3, 2, 2, 1, + 7, 5, 5, 1, 5, 2, 2, 1, 5, 3, 3, 1, 3, 2, 2, 1, 5, 4, 4, 1, 4, 2, 2, 1, 4, 3, + 3, 1, 3, 2, 2, 1, 7, 6, 6, 1, 6, 2, 2, 1, 6, 3, 3, 1, 3, 2, 2, 1, 6, 4, 4, 1, + 4, 2, 2, 1, 4, 3, 3, 1, 3, 2, 2, 1, 6, 5, 5, 1, 5, 2, 2, 1, 5, 3, 3, 1, 3, 2, + 2, 1, 5, 4, 4, 1, 4, 2, 2, 1, 4, 3, 3, 1, 3, 2, 2, 1, 8, 8, 8, 8, 8, 8, 8, 2, + 8, 8, 8, 3, 8, 3, 3, 2, 8, 8, 8, 4, 8, 4, 4, 2, 8, 4, 4, 3, 4, 3, 3, 2, 8, 8, + 8, 5, 8, 5, 5, 2, 8, 5, 5, 3, 5, 3, 3, 2, 8, 5, 5, 4, 5, 4, 4, 2, 5, 4, 4, 3, + 4, 3, 3, 2, 8, 8, 8, 6, 8, 6, 6, 2, 8, 6, 6, 3, 6, 3, 3, 2, 8, 6, 6, 4, 6, 4, + 4, 2, 6, 4, 4, 3, 4, 3, 3, 2, 8, 6, 6, 5, 6, 5, 5, 2, 6, 5, 5, 3, 5, 3, 3, 2, + 6, 5, 5, 4, 5, 4, 4, 2, 5, 4, 4, 3, 4, 3, 3, 2, 8, 8, 8, 7, 8, 7, 7, 2, 8, 7, + 7, 3, 7, 3, 3, 2, 8, 7, 7, 4, 7, 4, 4, 2, 7, 4, 4, 3, 4, 3, 3, 2, 8, 7, 7, 5, + 7, 5, 5, 2, 7, 5, 5, 3, 5, 3, 3, 2, 7, 5, 5, 4, 5, 4, 4, 2, 5, 4, 4, 3, 4, 3, + 3, 2, 8, 7, 7, 6, 7, 6, 6, 2, 7, 6, 6, 3, 6, 3, 3, 2, 7, 6, 6, 4, 6, 4, 4, 2, + 6, 4, 4, 3, 4, 3, 3, 2, 7, 6, 6, 5, 6, 5, 5, 2, 6, 5, 5, 3, 5, 3, 3, 2, 6, 5, + 5, 4, 5, 4, 4, 2, 5, 4, 4, 3, 4, 3, 3, 2, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, + 8, 8, 8, 3, 8, 8, 8, 8, 8, 8, 8, 4, 8, 8, 8, 4, 8, 4, 4, 3, 8, 8, 8, 8, 8, 8, + 8, 5, 8, 8, 8, 5, 8, 5, 5, 3, 8, 8, 8, 5, 8, 5, 5, 4, 8, 5, 5, 4, 5, 4, 4, 3, + 8, 8, 8, 8, 8, 8, 8, 6, 8, 8, 8, 6, 8, 6, 6, 3, 8, 8, 8, 6, 8, 6, 6, 4, 8, 6, + 6, 4, 6, 4, 4, 3, 8, 8, 8, 6, 8, 6, 6, 5, 8, 6, 6, 5, 6, 5, 5, 3, 8, 6, 6, 5, + 6, 5, 5, 4, 6, 5, 5, 4, 5, 4, 4, 3, 8, 8, 8, 8, 8, 8, 8, 7, 8, 8, 8, 7, 8, 7, + 7, 3, 8, 8, 8, 7, 8, 7, 7, 4, 8, 7, 7, 4, 7, 4, 4, 3, 8, 8, 8, 7, 8, 7, 7, 5, + 8, 7, 7, 5, 7, 5, 5, 3, 8, 7, 7, 5, 7, 5, 5, 4, 7, 5, 5, 4, 5, 4, 4, 3, 8, 8, + 8, 7, 8, 7, 7, 6, 8, 7, 7, 6, 7, 6, 6, 3, 8, 7, 7, 6, 7, 6, 6, 4, 7, 6, 6, 4, + 6, 4, 4, 3, 8, 7, 7, 6, 7, 6, 6, 5, 7, 6, 6, 5, 6, 5, 5, 3, 7, 6, 6, 5, 6, 5, + 5, 4, 6, 5, 5, 4, 5, 4, 4, 3, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, + 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 4, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, + 8, 8, 8, 8, 8, 5, 8, 8, 8, 8, 8, 8, 8, 5, 8, 8, 8, 5, 8, 5, 5, 4, 8, 8, 8, 8, + 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 6, 8, 8, 8, 8, 8, 8, 8, 6, 8, 8, 8, 6, 8, 6, + 6, 4, 8, 8, 8, 8, 8, 8, 8, 6, 8, 8, 8, 6, 8, 6, 6, 5, 8, 8, 8, 6, 8, 6, 6, 5, + 8, 6, 6, 5, 6, 5, 5, 4, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 7, 8, 8, + 8, 8, 8, 8, 8, 7, 8, 8, 8, 7, 8, 7, 7, 4, 8, 8, 8, 8, 8, 8, 8, 7, 8, 8, 8, 7, + 8, 7, 7, 5, 8, 8, 8, 7, 8, 7, 7, 5, 8, 7, 7, 5, 7, 5, 5, 4, 8, 8, 8, 8, 8, 8, + 8, 7, 8, 8, 8, 7, 8, 7, 7, 6, 8, 8, 8, 7, 8, 7, 7, 6, 8, 7, 7, 6, 7, 6, 6, 4, + 8, 8, 8, 7, 8, 7, 7, 6, 8, 7, 7, 6, 7, 6, 6, 5, 8, 7, 7, 6, 7, 6, 6, 5, 7, 6, + 6, 5, 6, 5, 5, 4, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, + 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, + 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 5, 8, 8, 8, 8, 8, 8, 8, 8, + 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 6, 8, 8, + 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 6, 8, 8, 8, 8, 8, 8, 8, 6, 8, 8, 8, 6, + 8, 6, 6, 5, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, + 8, 8, 8, 8, 8, 8, 8, 8, 8, 7, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 7, + 8, 8, 8, 8, 8, 8, 8, 7, 8, 8, 8, 7, 8, 7, 7, 5, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, + 8, 8, 8, 8, 8, 7, 8, 8, 8, 8, 8, 8, 8, 7, 8, 8, 8, 7, 8, 7, 7, 6, 8, 8, 8, 8, + 8, 8, 8, 7, 8, 8, 8, 7, 8, 7, 7, 6, 8, 8, 8, 7, 8, 7, 7, 6, 8, 7, 7, 6, 7, 6, + 6, 5, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, + 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, + 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, + 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, + 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 6, + 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, + 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, + 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 7, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, + 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 7, 8, 8, 8, 8, 8, 8, 8, 8, + 8, 8, 8, 8, 8, 8, 8, 7, 8, 8, 8, 8, 8, 8, 8, 7, 8, 8, 8, 7, 8, 7, 7, 6, 8, 8, + 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, + 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, + 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, + 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, + 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, + 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, + 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, + 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, + 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, + 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 7 +}; + +static inline uint64_t _select64(uint64_t x, int k) +{ + if (k >= popcnt(x)) { return 64; } + + const uint64_t kOnesStep4 = 0x1111111111111111ULL; + const uint64_t kOnesStep8 = 0x0101010101010101ULL; + const uint64_t kMSBsStep8 = 0x80ULL * kOnesStep8; + + uint64_t s = x; + s = s - ((s & 0xA * kOnesStep4) >> 1); + s = (s & 0x3 * kOnesStep4) + ((s >> 2) & 0x3 * kOnesStep4); + s = (s + (s >> 4)) & 0xF * kOnesStep8; + uint64_t byteSums = s * kOnesStep8; + + uint64_t kStep8 = k * kOnesStep8; + uint64_t geqKStep8 = (((kStep8 | kMSBsStep8) - byteSums) & kMSBsStep8); + uint64_t place = popcnt(geqKStep8) * 8; + uint64_t byteRank = k - (((byteSums << 8) >> place) & (uint64_t)(0xFF)); + return place + kSelectInByte[((x >> place) & 0xFF) | (byteRank << 8)]; +} + +// Returns the position of the rank'th 1. (rank = 0 returns the 1st 1) +// Returns 64 if there are fewer than rank+1 1s. +static inline uint64_t bitselect(uint64_t val, int rank) { +#ifdef __SSE4_2_ + uint64_t i = 1ULL << rank; + asm("pdep %[val], %[mask], %[val]" + : [val] "+r" (val) + : [mask] "r" (i)); + asm("tzcnt %[bit], %[index]" + : [index] "=r" (i) + : [bit] "g" (val) + : "cc"); + return i; +#endif + return _select64(val, rank); +} + +static inline uint64_t bitselectv(const uint64_t val, int ignore, int rank) +{ + return bitselect(val & ~BITMASK(ignore % 64), rank); +} + +#if BITS_PER_SLOT > 0 +static inline qfblock * get_block(const QF *qf, uint64_t block_index) +{ + return &qf->blocks[block_index]; +} +#else +static inline qfblock * get_block(const QF *qf, uint64_t block_index) +{ + // printf("block = %p\n",(void*)(((char *)qf->blocks) + block_index * (sizeof(qfblock) + + // qf->metadata->bits_per_slot * 8 + + // 8*qf->metadata->fixed_counter_size + + // 8*qf->metadata->tag_bits + // )) ); + //printf("blocks start=%p\n",qf->blocks ); + return (qfblock *)(((char *)qf->blocks) + block_index * (sizeof(qfblock) + + qf->metadata->bits_per_slot * 8 + )); +} +#endif + +static inline int is_runend(const QF *qf, uint64_t index) +{ + return (METADATA_WORD(qf, runends, index) >> ((index % SLOTS_PER_BLOCK) % + 64)) & 1ULL; +} + +static inline int is_occupied(const QF *qf, uint64_t index) +{ + return (METADATA_WORD(qf, occupieds, index) >> ((index % SLOTS_PER_BLOCK) % + 64)) & 1ULL; +} + +#if BITS_PER_SLOT == 8 || BITS_PER_SLOT == 16 || BITS_PER_SLOT == 32 || BITS_PER_SLOT == 64 + +static inline uint64_t get_slot(const QF *qf, uint64_t index) +{ + assert(index < qf->metadata->xnslots); + return get_block(qf, index / SLOTS_PER_BLOCK)->slots[index % SLOTS_PER_BLOCK]; +} + +static inline void set_slot(const QF *qf, uint64_t index, uint64_t value) +{ + assert(index < qf->metadata->xnslots); + get_block(qf, index / SLOTS_PER_BLOCK)->slots[index % SLOTS_PER_BLOCK] = + value & BITMASK(qf->metadata->bits_per_slot); +} + +#elif BITS_PER_SLOT > 0 + +/* Little-endian code .... Big-endian is TODO */ + +static inline uint64_t get_slot(const QF *qf, uint64_t index) +{ + /* Should use __uint128_t to support up to 64-bit remainders, but gcc seems + * to generate buggy code. :/ */ + assert(index < qf->metadata->xnslots); + uint64_t *p = (uint64_t *)&get_block(qf, index / + SLOTS_PER_BLOCK)->slots[(index % + SLOTS_PER_BLOCK) + * BITS_PER_SLOT / 8]; + return (uint64_t)(((*p) >> (((index % SLOTS_PER_BLOCK) * BITS_PER_SLOT) % + 8)) & BITMASK(BITS_PER_SLOT)); +} + +static inline void set_slot(const QF *qf, uint64_t index, uint64_t value) +{ + /* Should use __uint128_t to support up to 64-bit remainders, but gcc seems + * to generate buggy code. :/ */ + assert(index < qf->metadata->xnslots); + + uint64_t *p = (uint64_t *)&get_block(qf, index / + SLOTS_PER_BLOCK)->slots[(index % + SLOTS_PER_BLOCK) + * BITS_PER_SLOT / 8]; + uint64_t t = *p; + uint64_t mask = BITMASK(BITS_PER_SLOT); + uint64_t v = value; + int shift = ((index % SLOTS_PER_BLOCK) * BITS_PER_SLOT) % 8; + mask <<= shift; + v <<= shift; + t &= ~mask; + t |= v; + *p = t; +} + +#else + + +/* Little-endian code .... Big-endian is TODO */ + +static inline uint64_t _get_slot(const QF *qf, uint64_t index) +{ + assert(index < qf->metadata->xnslots); + /* Should use __uint128_t to support up to 64-bit remainders, but gcc seems + * to generate buggy code. :/ */ + + uint64_t *p = (uint64_t *)&get_block(qf, index / + SLOTS_PER_BLOCK)->slots[(index % + SLOTS_PER_BLOCK) + * qf->metadata->bits_per_slot / 8]; + return (uint64_t)(((*p) >> (((index % SLOTS_PER_BLOCK) * + qf->metadata->bits_per_slot) % 8)) & + BITMASK(qf->metadata->bits_per_slot)); +} + +static inline void _set_slot(const QF *qf, uint64_t index, uint64_t value) +{ + assert(index < qf->metadata->xnslots); + /* Should use __uint128_t to support up to 64-bit remainders, but gcc seems + * to generate buggy code. :/ */ + //printf("ss %d\n",(index %SLOTS_PER_BLOCK)* qf->metadata->bits_per_slot / 8 ); + uint64_t *p = (uint64_t *)&get_block(qf, index / + SLOTS_PER_BLOCK)->slots[(index % + SLOTS_PER_BLOCK) + * qf->metadata->bits_per_slot / 8]; + + uint64_t t = *p; + uint64_t mask = BITMASK(qf->metadata->bits_per_slot); + uint64_t v = value; + int shift = ((index % SLOTS_PER_BLOCK) * qf->metadata->bits_per_slot) % 8; + mask <<= shift; + v <<= shift; + t &= ~mask; + t |= v; + *p = t; +} + +static inline void set_slot(const QF *qf, uint64_t index, uint64_t value){ + uint64_t original_value=_get_slot(qf,index); + value<<=qf->metadata->fixed_counter_size; + uint64_t mask=BITMASK(qf->metadata->fixed_counter_size); + original_value&=mask; + value|=original_value; + _set_slot(qf,index,value); +} + +static inline uint64_t get_slot(const QF *qf, uint64_t index) +{ + uint64_t mask=BITMASK(qf->metadata->key_remainder_bits); + uint64_t t=_get_slot(qf,index); + t >>= qf->metadata->fixed_counter_size; + + return t&mask; +} + + +#endif + +static inline uint64_t get_fixed_counter(const QF *qf, uint64_t index) +{ + uint64_t t=_get_slot(qf,index); + uint64_t mask=BITMASK(qf->metadata->fixed_counter_size); + return t&mask; + // uint64_t res=0; + // uint64_t base=1; + // uint64_t* p=(uint64_t*)((uint8_t*)get_block(qf, index /SLOTS_PER_BLOCK)->slots+ + // (SLOTS_PER_BLOCK * qf->metadata->bits_per_slot )/ 8); + // + // for(int i=qf->metadata->fixed_counter_size-1;i>=0;i--){ + // res+= base*(( p[i] >> ((index % SLOTS_PER_BLOCK) %64)) & 1ULL); + // base*=2; + // } + // + // return res; +} + inline void set_fixed_counter(const QF *qf, uint64_t index,uint64_t value) +{ + uint64_t mask=BITMASK(qf->metadata->fixed_counter_size); + uint64_t t=value & mask; + uint64_t original_value=_get_slot(qf,index); + original_value&= ~mask; + t|=original_value; + _set_slot(qf,index,t); + // //printf("bits per slot =%lu, fixed counter =%lu, tag_bits=%lu\n", + // //qf->metadata->bits_per_slot,qf->metadata->fixed_counter_size,qf->metadata->tag_bits ); + // //printf("slots start=%p\n",(void*) get_block(qf, index /SLOTS_PER_BLOCK)->slots); + // uint64_t* p=((uint64_t*)&get_block(qf, index /SLOTS_PER_BLOCK)->slots) + + // (qf->metadata->bits_per_slot) ; + // printf("block start=%p\n", (void*)get_block(qf, index /SLOTS_PER_BLOCK)); + // printf("slots start=%p\n", (void*)&get_block(qf, index /SLOTS_PER_BLOCK)->slots); + // //printf("fixed counter=%p index=%lu , value=%lu add=%d\n",(void*)p,index,value,(8 * qf->metadata->bits_per_slot) ); + // //printf("diff=%d\n",(char*)p-(char*) get_block(qf, index /SLOTS_PER_BLOCK) ); + // uint64_t bitmask=1ULL << ((index % SLOTS_PER_BLOCK) %64); + // + // int i= qf->metadata->fixed_counter_size-1 ; + // //printf("fp=%p\n",&p[i]); + // //printf("fp=%p\n",&p[0]); + // for(;i>=0;i--){ + // //printf("fp=%p\n",&p[i]); + // if(value%2){ + // p[i]|= bitmask; + // } + // else{ + // p[i]&= ~(bitmask); + // } + // value=value>>1; + // + // } + // //printf("finish\n" ); + + +} + +static inline uint64_t get_tag(const QF *qf, uint64_t index) +{ + uint64_t mask=BITMASK(qf->metadata->tag_bits); + uint64_t t=_get_slot(qf,index); + t >>= (qf->metadata->fixed_counter_size+qf->metadata->key_remainder_bits); + return t&mask; +} +static inline void set_tag(const QF *qf, uint64_t index,uint64_t value) +{ + uint64_t original_value=_get_slot(qf,index); + value<<=(qf->metadata->fixed_counter_size+qf->metadata->key_remainder_bits); + uint64_t mask=BITMASK(qf->metadata->fixed_counter_size+qf->metadata->key_remainder_bits); + original_value&=mask; + value|=original_value; + _set_slot(qf,index,value); + +} + + + +static inline uint64_t run_end(const QF *qf, uint64_t hash_bucket_index); + +static inline uint64_t block_offset(const QF *qf, uint64_t blockidx) +{ + /* If we have extended counters and a 16-bit (or larger) offset + field, then we can safely ignore the possibility of overflowing + that field. */ + if (sizeof(qf->blocks[0].offset) > 1 || + get_block(qf, blockidx)->offset < BITMASK(8*sizeof(qf->blocks[0].offset))) + return get_block(qf, blockidx)->offset; + + return run_end(qf, SLOTS_PER_BLOCK * blockidx - 1) - SLOTS_PER_BLOCK * + blockidx + 1; +} + +static inline uint64_t run_end(const QF *qf, uint64_t hash_bucket_index) +{ + uint64_t bucket_block_index = hash_bucket_index / SLOTS_PER_BLOCK; + uint64_t bucket_intrablock_offset = hash_bucket_index % SLOTS_PER_BLOCK; + uint64_t bucket_blocks_offset = block_offset(qf, bucket_block_index); + + uint64_t bucket_intrablock_rank = bitrank(get_block(qf, + bucket_block_index)->occupieds[0], + bucket_intrablock_offset); + + if (bucket_intrablock_rank == 0) { + if (bucket_blocks_offset <= bucket_intrablock_offset) + return hash_bucket_index; + else + return SLOTS_PER_BLOCK * bucket_block_index + bucket_blocks_offset - 1; + } + + uint64_t runend_block_index = bucket_block_index + bucket_blocks_offset / + SLOTS_PER_BLOCK; + uint64_t runend_ignore_bits = bucket_blocks_offset % SLOTS_PER_BLOCK; + uint64_t runend_rank = bucket_intrablock_rank - 1; + uint64_t runend_block_offset = bitselectv(get_block(qf, + runend_block_index)->runends[0], + runend_ignore_bits, runend_rank); + if (runend_block_offset == SLOTS_PER_BLOCK) { + if (bucket_blocks_offset == 0 && bucket_intrablock_rank == 0) { + /* The block begins in empty space, and this bucket is in that region of + * empty space */ + return hash_bucket_index; + } else { + do { + runend_rank -= popcntv(get_block(qf, + runend_block_index)->runends[0], + runend_ignore_bits); + runend_block_index++; + runend_ignore_bits = 0; + runend_block_offset = bitselectv(get_block(qf, + runend_block_index)->runends[0], + runend_ignore_bits, runend_rank); + } while (runend_block_offset == SLOTS_PER_BLOCK); + } + } + + uint64_t runend_index = SLOTS_PER_BLOCK * runend_block_index + + runend_block_offset; + if (runend_index < hash_bucket_index) + return hash_bucket_index; + else + return runend_index; +} + +static inline int offset_lower_bound(const QF *qf, uint64_t slot_index) +{ + const qfblock * b = get_block(qf, slot_index / SLOTS_PER_BLOCK); + const uint64_t slot_offset = slot_index % SLOTS_PER_BLOCK; + const uint64_t boffset = b->offset; + const uint64_t occupieds = b->occupieds[0] & BITMASK(slot_offset+1); + assert(SLOTS_PER_BLOCK == 64); + if (boffset <= slot_offset) { + const uint64_t runends = (b->runends[0] & BITMASK(slot_offset)) >> boffset; + return popcnt(occupieds) - popcnt(runends); + } + return boffset - slot_offset + popcnt(occupieds); +} + +static inline int is_empty(const QF *qf, uint64_t slot_index) +{ + return offset_lower_bound(qf, slot_index) == 0; +} + +static inline int might_be_empty(const QF *qf, uint64_t slot_index) +{ + return !is_occupied(qf, slot_index) + && !is_runend(qf, slot_index); +} + +static inline int probably_is_empty(const QF *qf, uint64_t slot_index) +{ + return get_slot(qf, slot_index) == 0 + && !is_occupied(qf, slot_index) + && !is_runend(qf, slot_index); +} + +static inline uint64_t find_first_empty_slot(QF *qf, uint64_t from) +{ + do { + int t = offset_lower_bound(qf, from); + assert(t>=0); + + if (t == 0) + break; + from = from + t; + } while(1); + return from; +} + +static inline uint64_t shift_into_b(const uint64_t a, const uint64_t b, + const int bstart, const int bend, + const int amount) +{ + const uint64_t a_component = bstart == 0 ? (a >> (64 - amount)) : 0; + const uint64_t b_shifted_mask = BITMASK(bend - bstart) << bstart; + const uint64_t b_shifted = ((b_shifted_mask & b) << amount) & b_shifted_mask; + const uint64_t b_mask = ~b_shifted_mask; + return a_component | b_shifted | (b & b_mask); +} + +#if BITS_PER_SLOT == 8 || BITS_PER_SLOT == 16 || BITS_PER_SLOT == 32 || BITS_PER_SLOT == 64 + +static inline void shift_remainders(QF *qf, uint64_t start_index, uint64_t + empty_index) +{ + uint64_t start_block = start_index / SLOTS_PER_BLOCK; + uint64_t start_offset = start_index % SLOTS_PER_BLOCK; + uint64_t empty_block = empty_index / SLOTS_PER_BLOCK; + uint64_t empty_offset = empty_index % SLOTS_PER_BLOCK; + + assert (start_index <= empty_index && empty_index < qf->metadata->xnslots); + + while (start_block < empty_block) { + memmove(&get_block(qf, empty_block)->slots[1], + &get_block(qf, empty_block)->slots[0], + empty_offset * sizeof(qf->blocks[0].slots[0])); + get_block(qf, empty_block)->slots[0] = get_block(qf, + empty_block-1)->slots[SLOTS_PER_BLOCK-1]; + empty_block--; + empty_offset = SLOTS_PER_BLOCK-1; + } + + memmove(&get_block(qf, empty_block)->slots[start_offset+1], + &get_block(qf, empty_block)->slots[start_offset], + (empty_offset - start_offset) * sizeof(qf->blocks[0].slots[0])); +} + +#else + +#define REMAINDER_WORD(qf, i) ((uint64_t *)&(get_block(qf, (i)/qf->metadata->bits_per_slot)->slots[8 * ((i) % qf->metadata->bits_per_slot)])) + +static inline void shift_remainders(QF *qf, const uint64_t start_index, const + uint64_t empty_index) +{ + uint64_t last_word = (empty_index + 1) * qf->metadata->bits_per_slot / 64; + const uint64_t first_word = start_index * qf->metadata->bits_per_slot / 64; + int bend = ((empty_index + 1) * qf->metadata->bits_per_slot) % 64; + const int bstart = (start_index * qf->metadata->bits_per_slot) % 64; + + while (last_word != first_word) { + *REMAINDER_WORD(qf, last_word) = shift_into_b(*REMAINDER_WORD(qf, last_word-1), + *REMAINDER_WORD(qf, last_word), + 0, bend, qf->metadata->bits_per_slot); + last_word--; + bend = 64; + } + *REMAINDER_WORD(qf, last_word) = shift_into_b(0, *REMAINDER_WORD(qf, + last_word), + bstart, bend, + qf->metadata->bits_per_slot); +} + +#endif + +static inline void qf_dump_block(const QF *qf, uint64_t i) +{ + uint64_t j; + printf("#Block %lu \n",i ); + printf("%-192d", get_block(qf, i)->offset); + printf("\n"); + + for (j = 0; j < SLOTS_PER_BLOCK; j++) + printf("%02lx ", j); + printf("\n"); + + for (j = 0; j < SLOTS_PER_BLOCK; j++) + printf(" %d ", (get_block(qf, i)->occupieds[j/64] & (1ULL << (j%64))) ? 1 : 0); + printf("\n"); + + for (j = 0; j < SLOTS_PER_BLOCK; j++) + printf(" %d ", (get_block(qf, i)->runends[j/64] & (1ULL << (j%64))) ? 1 : 0); + printf("\n"); + +#if BITS_PER_SLOT == 8 || BITS_PER_SLOT == 16 || BITS_PER_SLOT == 32 + for (j = 0; j < SLOTS_PER_BLOCK; j++) + printf("%02x ", get_block(qf, i)->slots[j]); +#elif BITS_PER_SLOT == 64 + for (j = 0; j < SLOTS_PER_BLOCK; j++) + printf("%02lx ", get_block(qf, i)->slots[j]); +#else + //for (j = 0; j < SLOTS_PER_BLOCK * qf->metadata->bits_per_slot / 8; j++) + // printf("%02x ", get_block(qf, i)->slots[j]); + +#endif + +for(int j=0;j<64;j++) +{ + printf("%lu ", get_slot(qf,j+64*i)); +} + + printf("\n fixed counter \n"); + + for(int j=0;j<64;j++) + { + printf("%lu ", get_fixed_counter(qf,j+64*i)); + } + + printf("\n tags \n"); + + for(int j=0;j<64;j++) + { + printf("%lu ", get_tag(qf,j+64*i)); + } + + + printf("\n"); + printf("\n"); +} + +void qf_dump(const QF *qf) +{ + uint64_t i; + + printf("%lu %lu %lu\n", + qf->metadata->nblocks, + qf->metadata->ndistinct_elts, + qf->metadata->nelts); + + for (i = 0; i < qf->metadata->nblocks; i++) { + qf_dump_block(qf, i); + } + printf("End\n"); + + + + +} + +static inline void find_next_n_empty_slots(QF *qf, uint64_t from, uint64_t n, + uint64_t *indices) +{ + while (n) { + indices[--n] = find_first_empty_slot(qf, from); + from = indices[n] + 1; + } +} + +static inline void shift_slots(QF *qf, int64_t first, uint64_t last, uint64_t + distance) +{ + int64_t i; + if (distance == 1) + shift_remainders(qf, first, last+1); + else + for (i = last; i >= first; i--) + _set_slot(qf, i + distance, _get_slot(qf, i)); +} + +static inline void shift_runends(QF *qf, int64_t first, uint64_t last, + uint64_t distance) +{ + assert(last < qf->metadata->xnslots && distance < 64); + uint64_t first_word = first / 64; + uint64_t bstart = first % 64; + uint64_t last_word = (last + distance + 1) / 64; + uint64_t bend = (last + distance + 1) % 64; + + if (last_word != first_word) { + METADATA_WORD(qf, runends, 64*last_word) = shift_into_b(METADATA_WORD(qf, runends, 64*(last_word-1)), + METADATA_WORD(qf, runends, 64*last_word), + 0, bend, distance); + bend = 64; + last_word--; + while (last_word != first_word) { + METADATA_WORD(qf, runends, 64*last_word) = shift_into_b(METADATA_WORD(qf, runends, 64*(last_word-1)), + METADATA_WORD(qf, runends, 64*last_word), + 0, bend, distance); + last_word--; + } + } + METADATA_WORD(qf, runends, 64*last_word) = shift_into_b(0, METADATA_WORD(qf, + runends, + 64*last_word), + bstart, bend, distance); + +} + +// static inline void shift_fixed_counters(QF *qf, int64_t first, uint64_t last, +// uint64_t distance) +// { +// assert(last < qf->metadata->xnslots && distance < 64); +// uint64_t first_word = first / 64; +// uint64_t bstart = first % 64; +// uint64_t last_word = (last + distance + 1) / 64; +// uint64_t bend = (last + distance + 1) % 64; +// uint64_t* curr, *prev; +// uint64_t tmp =last_word, tmp_bend=bend; +// for(int i=0;imetadata->fixed_counter_size;i++){ +// last_word=tmp; +// bend=tmp_bend; +// if (last_word != first_word) { +// curr=(uint64_t*)((uint8_t*)get_block(qf, last_word)->slots+ +// (SLOTS_PER_BLOCK * qf->metadata->bits_per_slot) / 8); +// prev=(uint64_t*)((uint8_t*)get_block(qf, last_word-1)->slots+ +// (SLOTS_PER_BLOCK * qf->metadata->bits_per_slot) / 8); +// curr[i] = shift_into_b(prev[i],curr[i],0, bend, distance); +// bend = 64; +// last_word--; +// while (last_word != first_word) { +// curr=(uint64_t*)((uint8_t*)get_block(qf, last_word)->slots+(SLOTS_PER_BLOCK * qf->metadata->bits_per_slot / 8)); +// prev=(uint64_t*)((uint8_t*)get_block(qf, last_word-1)->slots+(SLOTS_PER_BLOCK * qf->metadata->bits_per_slot / 8)); +// curr[i] = shift_into_b(prev[i],curr[i],0, bend, distance); +// last_word--; +// } +// } +// curr=(uint64_t*)((uint8_t*)get_block(qf, last_word)->slots+(SLOTS_PER_BLOCK * qf->metadata->bits_per_slot / 8)); +// curr[i] = shift_into_b(0,curr[i], bstart, bend, distance); +// } +// +// } + +// static inline void shift_tags(QF *qf, int64_t first, uint64_t last, +// uint64_t distance) +// { +// assert(last < qf->metadata->xnslots && distance < 64); +// uint64_t first_word = first / 64; +// uint64_t bstart = first % 64; +// uint64_t last_word = (last + distance + 1) / 64; +// uint64_t bend = (last + distance + 1) % 64; +// uint64_t* curr, *prev; +// uint64_t tmp =last_word, tmp_bend=bend; +// for(int i=0;imetadata->tag_bits;i++){ +// last_word=tmp; +// bend=tmp_bend; +// if (last_word != first_word) { +// curr=(uint64_t*)((uint8_t*)get_block(qf, last_word)->slots+ +// (8 *(qf->metadata->bits_per_slot + qf->metadata->fixed_counter_size ))); +// prev=(uint64_t*)((uint8_t*)get_block(qf, last_word-1)->slots+ +// (8 *(qf->metadata->bits_per_slot + qf->metadata->fixed_counter_size ))); +// curr[i] = shift_into_b(prev[i],curr[i],0, bend, distance); +// bend = 64; +// last_word--; +// while (last_word != first_word) { +// curr=(uint64_t*)((uint8_t*)get_block(qf, last_word)->slots+ +// (8 *(qf->metadata->bits_per_slot + qf->metadata->fixed_counter_size ))); +// prev=(uint64_t*)((uint8_t*)get_block(qf, last_word-1)->slots+ +// (8 *(qf->metadata->bits_per_slot + qf->metadata->fixed_counter_size ))); +// curr[i] = shift_into_b(prev[i],curr[i],0, bend, distance); +// last_word--; +// } +// } +// curr=(uint64_t*)((uint8_t*)get_block(qf, last_word)->slots+ +// (8 *(qf->metadata->bits_per_slot + qf->metadata->fixed_counter_size ))); +// curr[i] = shift_into_b(0,curr[i], bstart, bend, distance); +// } +// +// } + +static inline void insert_replace_slots_and_shift_remainders_and_runends_and_offsets(QF *qf, + int operation, + uint64_t bucket_index, + uint64_t overwrite_index, + const uint64_t *remainders, + const uint64_t *fixed_size_counters, + uint64_t total_remainders, + uint64_t noverwrites) +{ + uint64_t empties[67]; + uint64_t i; + int64_t ninserts = total_remainders - noverwrites; + uint64_t insert_index = overwrite_index + noverwrites; + if(qf->metadata->noccupied_slots+ninserts > qf->metadata->maximum_occupied_slots ) + { + throw std::overflow_error("QF is 95% full, cannot insert more items."); + } + //printf("remainder =%lu ,overwrite_index = %lu , insert_index=%lu , operation=%d, noverwites=%lu total_remainders=%lu nnserts=%lu \n", remainders[0],overwrite_index,insert_index,operation,noverwrites,total_remainders,ninserts); + if (ninserts > 0) { + /* First, shift things to create n empty spaces where we need them. */ + //printf("shift %lu, ninserts=%lu\n",insert_index,ninserts ); + + find_next_n_empty_slots(qf, insert_index, ninserts, empties); + for (i = 0; i < ninserts - 1; i++){ + shift_slots(qf, empties[i+1] + 1, empties[i] - 1, i + 1); + } + shift_slots(qf, insert_index, empties[ninserts - 1] - 1, ninserts); + + + + for (i = 0; i < ninserts - 1; i++) + shift_runends(qf, empties[i+1] + 1, empties[i] - 1, i + 1); + shift_runends(qf, insert_index, empties[ninserts - 1] - 1, ninserts); + + + + // for (i = 0; i < ninserts - 1; i++) + // shift_fixed_counters(qf, empties[i+1] + 1, empties[i] - 1, i + 1); + // shift_fixed_counters(qf, insert_index, empties[ninserts - 1] - 1, ninserts); + // + // + // for (i = 0; i < ninserts - 1; i++) + // shift_tags(qf, empties[i+1] + 1, empties[i] - 1, i + 1); + // shift_tags(qf, insert_index, empties[ninserts - 1] - 1, ninserts); + // + + + + for (i = noverwrites; i < total_remainders - 1; i++) + METADATA_WORD(qf, runends, overwrite_index + i) &= ~(1ULL << + (((overwrite_index + + i) % + SLOTS_PER_BLOCK) + % 64)); + // for (i = noverwrites; i < total_remainders - 1; i++) + // set_fixed_counter(qf,overwrite_index+i,0); + + + switch (operation) { + case 0: /* insert into empty bucket */ + assert (noverwrites == 0); + METADATA_WORD(qf, runends, overwrite_index + total_remainders - 1) |= + 1ULL << (((overwrite_index + total_remainders - 1) % + SLOTS_PER_BLOCK) % 64); + break; + case 1: /* append to bucket */ + METADATA_WORD(qf, runends, overwrite_index + noverwrites - 1) &= + ~(1ULL << (((overwrite_index + noverwrites - 1) % SLOTS_PER_BLOCK) % + 64)); + METADATA_WORD(qf, runends, overwrite_index + total_remainders - 1) |= + 1ULL << (((overwrite_index + total_remainders - 1) % + SLOTS_PER_BLOCK) % 64); + break; + case 2: /* insert into bucket */ + METADATA_WORD(qf, runends, overwrite_index + total_remainders - 1) &= + ~(1ULL << (((overwrite_index + total_remainders - 1) % + SLOTS_PER_BLOCK) % 64)); + break; + default: + fprintf(stderr, "Invalid operation %d\n", operation); + abort(); + } + + uint64_t npreceding_empties = 0; + for (i = bucket_index / SLOTS_PER_BLOCK + 1; i <= empties[0]/SLOTS_PER_BLOCK; i++) { + while (npreceding_empties < ninserts && + empties[ninserts - 1 - npreceding_empties] / SLOTS_PER_BLOCK < i) + npreceding_empties++; + + if (get_block(qf, i)->offset + ninserts - npreceding_empties < BITMASK(8*sizeof(qf->blocks[0].offset))) + get_block(qf, i)->offset += ninserts - npreceding_empties; + else + get_block(qf, i)->offset = (uint8_t) BITMASK(8*sizeof(qf->blocks[0].offset)); + } + } + for (i = 0; i < total_remainders; i++){ + set_slot(qf, overwrite_index + i, remainders[i]); + set_fixed_counter(qf,overwrite_index +i,fixed_size_counters[i]); +// printf("fixed counter = %lu\n",fixed_size_counters[i] ); + } + + modify_metadata(qf, &qf->metadata->noccupied_slots, ninserts); +} + +static inline void remove_replace_slots_and_shift_remainders_and_runends_and_offsets(QF *qf, + int operation, + uint64_t bucket_index, + uint64_t overwrite_index, + const uint64_t *remainders, + const uint64_t *fcounters, + uint64_t total_remainders, + uint64_t old_length) +{ + uint64_t i; + + // Update the slots + for (i = 0; i < total_remainders; i++){ + set_slot(qf, overwrite_index + i, remainders[i]); + set_fixed_counter(qf, overwrite_index + i, fcounters[i]); + if(qf->metadata->tag_bits>0) + set_tag(qf, overwrite_index + i, 0); + } + + + // If this is the last thing in its run, then we may need to set a new runend bit + if (is_runend(qf, overwrite_index + old_length - 1)) { + if (total_remainders > 0) { + // If we're not deleting this entry entirely, then it will still the last entry in this run + METADATA_WORD(qf, runends, overwrite_index + total_remainders - 1) |= 1ULL << ((overwrite_index + total_remainders - 1) % 64); + } else if (overwrite_index > bucket_index && + !is_runend(qf, overwrite_index - 1)) { + // If we're deleting this entry entirely, but it is not the first entry in this run, + // then set the preceding entry to be the runend + METADATA_WORD(qf, runends, overwrite_index - 1) |= 1ULL << ((overwrite_index - 1) % 64); + } + } + + // shift slots back one run at a time + uint64_t original_bucket = bucket_index; + uint64_t current_bucket = bucket_index; + uint64_t current_slot = overwrite_index + total_remainders; + uint64_t current_distance = old_length - total_remainders; + + while (current_distance > 0) { + if (is_runend(qf, current_slot + current_distance - 1)) { + do { + current_bucket++; + } while (current_bucket < current_slot + current_distance && + !is_occupied(qf, current_bucket)); + } + + if (current_bucket <= current_slot) { + set_slot(qf, current_slot, get_slot(qf, current_slot + current_distance)); + set_fixed_counter(qf, current_slot, get_fixed_counter(qf, current_slot + current_distance)); + if(qf->metadata->tag_bits>0) + set_tag(qf, current_slot, get_tag(qf, current_slot + current_distance)); + + if (is_runend(qf, current_slot) != + is_runend(qf, current_slot + current_distance)) + METADATA_WORD(qf, runends, current_slot) ^= 1ULL << (current_slot % 64); + current_slot++; + + } else if (current_bucket <= current_slot + current_distance) { + uint64_t i; + for (i = current_slot; i < current_slot + current_distance; i++) { + set_slot(qf, i, 0); + set_fixed_counter(qf,i,0); + if(qf->metadata->tag_bits>0) + set_tag(qf,i,0); + METADATA_WORD(qf, runends, i) &= ~(1ULL << (i % 64)); + } + + current_distance = current_slot + current_distance - current_bucket; + current_slot = current_bucket; + } else { + current_distance = 0; + } + } + + // reset the occupied bit of the hash bucket index if the hash is the + // only item in the run and is removed completely. + if (operation && !total_remainders) + METADATA_WORD(qf, occupieds, bucket_index) &= ~(1ULL << (bucket_index % 64)); + + // update the offset bits. + // find the number of occupied slots in the original_bucket block. + // Then find the runend slot corresponding to the last run in the + // original_bucket block. + // Update the offset of the block to which it belongs. + uint64_t original_block = original_bucket / SLOTS_PER_BLOCK; + while (1 && old_length > total_remainders) { // we only update offsets if we shift/delete anything + int32_t last_occupieds_bit = bitscanreverse(get_block(qf, original_block)->occupieds[0]); + // there is nothing in the block + if (last_occupieds_bit == -1) { + if (get_block(qf, original_block + 1)->offset == 0) + break; + get_block(qf, original_block + 1)->offset = 0; + } else { + uint64_t last_occupieds_hash_index = SLOTS_PER_BLOCK * original_block + last_occupieds_bit; + uint64_t runend_index = run_end(qf, last_occupieds_hash_index); + // runend spans across the block + // update the offset of the next block + if (runend_index / SLOTS_PER_BLOCK == original_block) { // if the run ends in the same block + if (get_block(qf, original_block + 1)->offset == 0) + break; + get_block(qf, original_block + 1)->offset = 0; + } else if (runend_index / SLOTS_PER_BLOCK == original_block + 1) { // if the last run spans across one block + if (get_block(qf, original_block + 1)->offset == (runend_index % SLOTS_PER_BLOCK) + 1) + break; + get_block(qf, original_block + 1)->offset = (runend_index % SLOTS_PER_BLOCK) + 1; + } else { // if the last run spans across multiple blocks + uint64_t i; + for (i = original_block + 1; i < runend_index / SLOTS_PER_BLOCK - 1; i++) + get_block(qf, i)->offset = SLOTS_PER_BLOCK; + if (get_block(qf, runend_index / SLOTS_PER_BLOCK)->offset == (runend_index % SLOTS_PER_BLOCK) + 1) + break; + get_block(qf, runend_index / SLOTS_PER_BLOCK)->offset = (runend_index % SLOTS_PER_BLOCK) + 1; + } + } + original_block++; + } + + int num_slots_freed = old_length - total_remainders; + modify_metadata(qf, &qf->metadata->noccupied_slots, -num_slots_freed); + /*qf->metadata->noccupied_slots -= (old_length - total_remainders);*/ + if (!total_remainders) { + modify_metadata(qf, &qf->metadata->ndistinct_elts, -1); + /*qf->metadata->ndistinct_elts--;*/ + } +} + +/***************************************************************************** + * Code that uses the above to implement a QF with keys and inline counters. * + *****************************************************************************/ + +/* + Counter format: + 1- count <= 2^(fixed counter size) + Slots : [Remaining] + Fixed counters : [count-1] + + 2- count > 2^(fixed counter size) + Slots : [Remaining] [first digit] [second digit] ... [last digit] + Fixed counters : [Maximum] [Maximum] [Maximum] ... [up to Maximum -1] + + */ +static inline uint64_t *encode_counter(QF *qf, uint64_t remainder, uint64_t + counter, uint64_t *slots, uint64_t *fixed_size_counters) +{ + //printf("inserting %lu repeated %lu\n",remainder,counter); + const uint64_t slots_base = (1ULL << qf->metadata->key_remainder_bits) ; + uint64_t *p = slots; + uint64_t *pf = fixed_size_counters; + const uint64_t fixed_counter_max=(1ULL<metadata->fixed_counter_size)-1; + + if (counter == 0) + return p; + + counter--; + uint64_t fcounter_first=std::min(counter,fixed_counter_max); + counter-=(fcounter_first); + + //printf("first fixed counter =%lu\n", fcounter_first); + if(fcounter_first==fixed_counter_max){ + uint64_t max_count_in_fixed_counter=fixed_counter_max-1;// the fixed size count in the end of the counter should'nt be full + do{ + *--p=counter%slots_base; + *--pf=fixed_counter_max; + //printf("vcount = %lu\n",counter%slots_base ); + counter >>= qf->metadata->key_remainder_bits; + } while(counter>max_count_in_fixed_counter); + *(fixed_size_counters-1)=counter;// set the last counter + //printf("last fixed counter = %lu\n",counter); + } + + *--p = remainder; + *--pf=fcounter_first; + + + return p; +} + +/* Returns the length of the encoding. +REQUIRES: index points to first slot of a counter. */ +static inline uint64_t decode_counter(const QF *qf, uint64_t index, uint64_t + *remainder, uint64_t *count) +{ + + *remainder = get_slot(qf, index); + uint64_t fcount=get_fixed_counter(qf,index); + uint64_t tmp_count= fcount+1; + *count=0; + const uint64_t fixed_count_max=(1ULL << qf->metadata->fixed_counter_size)-1; + //printf("tmp count = %lu\n",tmp_count); + if(fcount == fixed_count_max){ + uint64_t no_digits=0; + do{ + index++; + no_digits++; + *count <<= qf->metadata->key_remainder_bits; + + fcount= get_fixed_counter(qf,index); + // printf("quer slot =%lu fixed count= %lu\n", get_slot(qf, index),fcount); + *count += get_slot(qf, index); + + }while(fcount == fixed_count_max); + *count += fcount<<(no_digits*qf->metadata->key_remainder_bits); + //printf("fixed vcount= %lu\n", fcount<<(no_digits*qf->metadata->bits_per_slot + qf->metadata->fixed_counter_size)); + } + *count += tmp_count; + return index; + +} + +/* return the next slot which corresponds to a + * different element + * */ +static inline uint64_t next_slot(QF *qf, uint64_t current) +{ + uint64_t rem = get_slot(qf, current); + current++; + + while (get_slot(qf, current) == rem && current <= qf->metadata->nslots) { + current++; + } + return current; +} + +// static inline bool insert1(QF *qf, __uint128_t hash, bool lock, bool spin) +// { +// uint64_t hash_remainder = hash & BITMASK(qf->metadata->bits_per_slot); +// uint64_t hash_bucket_index = hash >> qf->metadata->bits_per_slot; +// uint64_t hash_bucket_block_offset = hash_bucket_index % SLOTS_PER_BLOCK; +// +// if (lock) { +// if (!qf_lock(qf, hash_bucket_index, spin, true)) +// return false; +// } +// if (is_empty(qf, hash_bucket_index) /* might_be_empty(qf, hash_bucket_index) && runend_index == hash_bucket_index */) { +// METADATA_WORD(qf, runends, hash_bucket_index) |= 1ULL << +// (hash_bucket_block_offset % 64); +// set_slot(qf, hash_bucket_index, hash_remainder); +// METADATA_WORD(qf, occupieds, hash_bucket_index) |= 1ULL << +// (hash_bucket_block_offset % 64); +// +// /*modify_metadata(qf, &qf->metadata->ndistinct_elts, 1);*/ +// modify_metadata(qf, &qf->metadata->noccupied_slots, 1); +// /*modify_metadata(qf, &qf->metadata->nelts, 1);*/ +// } else { +// uint64_t runend_index = run_end(qf, hash_bucket_index); +// int operation = 0; /* Insert into empty bucket */ +// uint64_t insert_index = runend_index + 1; +// uint64_t new_value = hash_remainder; +// +// /* printf("RUNSTART: %02lx RUNEND: %02lx\n", runstart_index, runend_index); */ +// +// uint64_t runstart_index = hash_bucket_index == 0 ? 0 : run_end(qf, +// hash_bucket_index +// - 1) + 1; +// +// if (is_occupied(qf, hash_bucket_index)) { +// +// /* Find the counter for this remainder if it exists. */ +// uint64_t current_remainder = get_slot(qf, runstart_index); +// uint64_t zero_terminator = runstart_index; +// +// /* The counter for 0 is special. */ +// if (current_remainder == 0) { +// uint64_t t = runstart_index + 1; +// while (t < runend_index && get_slot(qf, t) != 0) +// t++; +// if (t < runend_index && get_slot(qf, t+1) == 0) +// zero_terminator = t+1; /* Three or more 0s */ +// else if (runstart_index < runend_index && get_slot(qf, runstart_index +// + 1) == 0) +// zero_terminator = runstart_index + 1; /* Exactly two 0s */ +// /* Otherwise, exactly one 0 (i.e. zero_terminator == runstart_index) */ +// +// /* May read past end of run, but that's OK because loop below +// can handle that */ +// if (hash_remainder != 0) { +// runstart_index = zero_terminator + 1; +// current_remainder = get_slot(qf, runstart_index); +// } +// } +// +// /* Skip over counters for other remainders. */ +// while (current_remainder < hash_remainder && runstart_index <= +// runend_index) { +// /* If this remainder has an extended counter, skip over it. */ +// if (runstart_index < runend_index && +// get_slot(qf, runstart_index + 1) < current_remainder) { +// runstart_index = runstart_index + 2; +// while (runstart_index < runend_index && +// get_slot(qf, runstart_index) != current_remainder) +// runstart_index++; +// runstart_index++; +// +// /* This remainder has a simple counter. */ +// } else { +// runstart_index++; +// } +// +// /* This may read past the end of the run, but the while loop +// condition will prevent us from using the invalid result in +// that case. */ +// current_remainder = get_slot(qf, runstart_index); +// } +// +// /* If this is the first time we've inserted the new remainder, +// and it is larger than any remainder in the run. */ +// if (runstart_index > runend_index) { +// operation = 1; +// insert_index = runstart_index; +// new_value = hash_remainder; +// /*modify_metadata(qf, &qf->metadata->ndistinct_elts, 1);*/ +// +// /* This is the first time we're inserting this remainder, but +// there are larger remainders already in the run. */ +// } else if (current_remainder != hash_remainder) { +// operation = 2; /* Inserting */ +// insert_index = runstart_index; +// new_value = hash_remainder; +// /*modify_metadata(qf, &qf->metadata->ndistinct_elts, 1);*/ +// +// /* Cases below here: we're incrementing the (simple or +// extended) counter for this remainder. */ +// +// /* If there's exactly one instance of this remainder. */ +// } else if (runstart_index == runend_index || +// (hash_remainder > 0 && get_slot(qf, runstart_index + 1) > +// hash_remainder) || +// (hash_remainder == 0 && zero_terminator == runstart_index)) { +// operation = 2; /* Insert */ +// insert_index = runstart_index; +// new_value = hash_remainder; +// +// /* If there are exactly two instances of this remainder. */ +// } else if ((hash_remainder > 0 && get_slot(qf, runstart_index + 1) == +// hash_remainder) || +// (hash_remainder == 0 && zero_terminator == runstart_index + 1)) { +// operation = 2; /* Insert */ +// insert_index = runstart_index + 1; +// new_value = 0; +// +// /* Special case for three 0s */ +// } else if (hash_remainder == 0 && zero_terminator == runstart_index + 2) { +// operation = 2; /* Insert */ +// insert_index = runstart_index + 1; +// new_value = 1; +// +// /* There is an extended counter for this remainder. */ +// } else { +// +// /* Move to the LSD of the counter. */ +// insert_index = runstart_index + 1; +// while (get_slot(qf, insert_index+1) != hash_remainder) +// insert_index++; +// +// /* Increment the counter. */ +// uint64_t digit, carry; +// do { +// carry = 0; +// digit = get_slot(qf, insert_index); +// // Convert a leading 0 (which is special) to a normal encoded digit +// if (digit == 0) { +// digit++; +// if (digit == current_remainder) +// digit++; +// } +// +// // Increment the digit +// digit = (digit + 1) & BITMASK(qf->metadata->bits_per_slot); +// +// // Ensure digit meets our encoding requirements +// if (digit == 0) { +// digit++; +// carry = 1; +// } +// if (digit == current_remainder) +// digit = (digit + 1) & BITMASK(qf->metadata->bits_per_slot); +// if (digit == 0) { +// digit++; +// carry = 1; +// } +// +// set_slot(qf, insert_index, digit); +// insert_index--; +// } while(insert_index > runstart_index && carry); +// +// /* If the counter needs to be expanded. */ +// if (insert_index == runstart_index && (carry > 0 || (current_remainder +// != 0 && digit >= +// current_remainder))) +// { +// operation = 2; /* insert */ +// insert_index = runstart_index + 1; +// if (!carry) /* To prepend a 0 before the counter if the MSD is greater than the rem */ +// new_value = 0; +// else if (carry) { /* Increment the new value because we don't use 0 to encode counters */ +// new_value = 2; +// /* If the rem is greater than or equal to the new_value then fail*/ +// assert(new_value < current_remainder); +// } +// } else { +// operation = -1; +// } +// } +// } +// +// if (operation >= 0) { +// uint64_t empty_slot_index = find_first_empty_slot(qf, runend_index+1); +// +// shift_remainders(qf, insert_index, empty_slot_index); +// +// set_slot(qf, insert_index, new_value); +// +// shift_runends(qf, insert_index, empty_slot_index-1, 1); +// shift_fixed_counters(qf, insert_index, empty_slot_index-1, 1); +// switch (operation) { +// case 0: +// METADATA_WORD(qf, runends, insert_index) |= 1ULL << ((insert_index +// % +// SLOTS_PER_BLOCK) +// % 64); +// break; +// case 1: +// METADATA_WORD(qf, runends, insert_index-1) &= ~(1ULL << +// (((insert_index-1) % +// SLOTS_PER_BLOCK) % +// 64)); +// METADATA_WORD(qf, runends, insert_index) |= 1ULL << ((insert_index +// % +// SLOTS_PER_BLOCK) +// % 64); +// break; +// case 2: +// METADATA_WORD(qf, runends, insert_index) &= ~(1ULL << +// ((insert_index % +// SLOTS_PER_BLOCK) % +// 64)); +// break; +// default: +// fprintf(stderr, "Invalid operation %d\n", operation); +// abort(); +// } +// /* +// * Increment the offset for each block between the hash bucket index +// * and block of the empty slot +// * */ +// uint64_t i; +// for (i = hash_bucket_index / SLOTS_PER_BLOCK + 1; i <= +// empty_slot_index/SLOTS_PER_BLOCK; i++) { +// if (get_block(qf, i)->offset < BITMASK(8*sizeof(qf->blocks[0].offset))) +// get_block(qf, i)->offset++; +// assert(get_block(qf, i)->offset != 0); +// } +// modify_metadata(qf, &qf->metadata->noccupied_slots, 1); +// } +// /*modify_metadata(qf, &qf->metadata->nelts, 1);*/ +// METADATA_WORD(qf, occupieds, hash_bucket_index) |= 1ULL << +// (hash_bucket_block_offset % 64); +// } +// +// if (lock) { +// qf_unlock(qf, hash_bucket_index, true); +// } +// +// return true; +// } + +static inline bool insert(QF *qf, __uint128_t hash, uint64_t count, bool lock=false, + bool spin=false) +{ + uint64_t hash_remainder = hash & BITMASK(qf->metadata->key_remainder_bits); + uint64_t hash_bucket_index = hash >> qf->metadata->key_remainder_bits; + uint64_t hash_bucket_block_offset = hash_bucket_index % SLOTS_PER_BLOCK; + /*uint64_t hash_bucket_lock_offset = hash_bucket_index % NUM_SLOTS_TO_LOCK;*/ + //printf("index= %lu remainder= %lu count=%lu\n",hash_bucket_index,hash_remainder,count); + if(hash_bucket_index > qf->metadata->xnslots){ + throw std::out_of_range("Insert is called with hash index out of range"); + } + if (lock) { + if (!qf_lock(qf, hash_bucket_index, spin, false)) + return false; + } + + uint64_t runend_index = run_end(qf, hash_bucket_index); + + /* Empty slot */ + if (might_be_empty(qf, hash_bucket_index) && runend_index == + hash_bucket_index) { + METADATA_WORD(qf, runends, hash_bucket_index) |= 1ULL << + (hash_bucket_block_offset % 64); + set_slot(qf, hash_bucket_index, hash_remainder); + set_fixed_counter(qf, hash_bucket_index, 0); + METADATA_WORD(qf, occupieds, hash_bucket_index) |= 1ULL << + (hash_bucket_block_offset % 64); + + modify_metadata(qf, &qf->metadata->ndistinct_elts, 1); + modify_metadata(qf, &qf->metadata->noccupied_slots, 1); + /*modify_metadata(qf, &qf->metadata->nelts, 1);*/ + /* This trick will, I hope, keep the fast case fast. */ + if (count > 1) { + insert(qf, hash, count - 1, false, false); + } + } else { /* Non-empty slot */ + uint64_t new_values[67]; + uint64_t new_fcounters[67]; + uint64_t total_remainders; + int64_t runstart_index = hash_bucket_index == 0 ? 0 : run_end(qf, + hash_bucket_index + - 1) + 1; + + if (!is_occupied(qf, hash_bucket_index)) { /* Empty bucket, but its slot is occupied. */ + uint64_t *p = encode_counter(qf, hash_remainder, count, &new_values[67],&new_fcounters[67]); + total_remainders=&new_values[67] - p; + insert_replace_slots_and_shift_remainders_and_runends_and_offsets(qf, + 0, + hash_bucket_index, + runstart_index, + p, + &new_fcounters[67]-total_remainders, + &new_values[67] - p, + 0); + modify_metadata(qf, &qf->metadata->ndistinct_elts, 1); + } else { /* Non-empty bucket */ + + uint64_t current_remainder, current_count, current_end; + + /* Find the counter for this remainder, if one exists. */ + current_end = decode_counter(qf, runstart_index, ¤t_remainder, + ¤t_count); + while (current_remainder < hash_remainder && !is_runend(qf, current_end)) { + runstart_index = current_end + 1; + current_end = decode_counter(qf, runstart_index, ¤t_remainder, + ¤t_count); + } + + /* If we reached the end of the run w/o finding a counter for this remainder, + then append a counter for this remainder to the run. */ + if (current_remainder < hash_remainder) { + uint64_t *p = encode_counter(qf, hash_remainder, count, &new_values[67],&new_fcounters[67]); + total_remainders=&new_values[67] - p; + insert_replace_slots_and_shift_remainders_and_runends_and_offsets(qf, + 1, /* Append to bucket */ + hash_bucket_index, + current_end + 1, + p, + &new_fcounters[67]-total_remainders, + &new_values[67] - p, + 0); + modify_metadata(qf, &qf->metadata->ndistinct_elts, 1); + /* Found a counter for this remainder. Add in the new count. */ + } else if (current_remainder == hash_remainder) { + uint64_t *p = encode_counter(qf, hash_remainder, current_count + count, &new_values[67],&new_fcounters[67]); + total_remainders=&new_values[67] - p; + insert_replace_slots_and_shift_remainders_and_runends_and_offsets(qf, + is_runend(qf, current_end) ? 1 : 2, + hash_bucket_index, + runstart_index, + p, + &new_fcounters[67]-total_remainders, + &new_values[67] - p, + current_end - runstart_index + 1); + /* No counter for this remainder, but there are larger + remainders, so we're not appending to the bucket. */ + } else { + uint64_t *p = encode_counter(qf, hash_remainder, count, &new_values[67],&new_fcounters[67]); + total_remainders=&new_values[67] - p; + insert_replace_slots_and_shift_remainders_and_runends_and_offsets(qf, + 2, /* Insert to bucket */ + hash_bucket_index, + runstart_index, + p, + &new_fcounters[67]-total_remainders, + &new_values[67] - p, + 0); + modify_metadata(qf, &qf->metadata->ndistinct_elts, 1); + } + } + METADATA_WORD(qf, occupieds, hash_bucket_index) |= 1ULL << (hash_bucket_block_offset % 64); + + /*modify_metadata(qf, &qf->metadata->nelts, count);*/ + } + + if (lock) { + qf_unlock(qf, hash_bucket_index, false); + } + + return true; +} + + bool qf_remove(QF *qf, uint64_t hash, uint64_t count , bool lock, bool spin) +{ + uint64_t hash_remainder = hash & BITMASK(qf->metadata->key_remainder_bits); + uint64_t hash_bucket_index = hash >> qf->metadata->key_remainder_bits; + uint64_t current_remainder, current_count, current_end; + uint64_t new_values[67]; + uint64_t new_fcounters[67]; + + if(hash_bucket_index > qf->metadata->xnslots){ + throw std::out_of_range("Remove function is called with hash index out of range"); + } + + + /* Empty bucket */ + if (!is_occupied(qf, hash_bucket_index)){ + return true; + } + + uint64_t runstart_index = hash_bucket_index == 0 ? 0 : run_end(qf, hash_bucket_index - 1) + 1; + uint64_t original_runstart_index = runstart_index; + int only_item_in_the_run = 0; + + /*Find the counter for this remainder, if one exists.*/ + current_end = decode_counter(qf, runstart_index, ¤t_remainder, ¤t_count); + while (current_remainder < hash_remainder && !is_runend(qf, current_end)) { + runstart_index = current_end + 1; + current_end = decode_counter(qf, runstart_index, ¤t_remainder, ¤t_count); + } + /* remainder not found in the given run */ + if (current_remainder != hash_remainder){ + return true; + } + + if (original_runstart_index == runstart_index && is_runend(qf, current_end)) + only_item_in_the_run = 1; + + + /* endode the new counter */ + uint64_t *p = encode_counter(qf, hash_remainder, + count>current_count? 0 : current_count-count, + &new_values[67],&new_fcounters[67]); + + uint64_t total_reminders=&new_values[67] - p; + // if(fcounter==0 && newcount==0){ + // total_reminders=0; + // p=&new_values[67]; + // } + if (lock) { + if (!qf_lock(qf, hash_bucket_index, spin, false)) + return false; + } + + remove_replace_slots_and_shift_remainders_and_runends_and_offsets(qf, + only_item_in_the_run, + hash_bucket_index, + runstart_index, + p, + &new_fcounters[67]-total_reminders, + total_reminders, + current_end - runstart_index + 1); + + + if (lock) { + qf_unlock(qf, hash_bucket_index, true); + } + + return true; + // update the nelements. + /*modify_metadata(qf, &qf->metadata->nelts, -count);*/ + /*qf->metadata->nelts -= count;*/ +} + +/*********************************************************************** + * Code that uses the above to implement key-value-counter operations. * + ***********************************************************************/ + +void qf_init(QF *qf, uint64_t nslots, uint64_t key_bits, uint64_t tag_bits,uint64_t fixed_counter_size, + bool mem, const char * path, uint32_t seed) +{ + //qf=(QF*)calloc(sizeof(QF),1); + uint64_t num_slots, xnslots, nblocks; + uint64_t key_remainder_bits, bits_per_slot; + uint64_t size; + + + if(popcnt(nslots) != 1){ + throw std::domain_error("nslots must be a power of 2"); + + } + num_slots = nslots; + + xnslots = nslots + 10*sqrt((double)nslots); + nblocks = (xnslots + SLOTS_PER_BLOCK - 1) / SLOTS_PER_BLOCK; + key_remainder_bits = key_bits; + while (nslots > 1) { + //assert(key_remainder_bits > 0); + key_remainder_bits--; + nslots >>= 1; + } + + bits_per_slot = key_remainder_bits+fixed_counter_size+tag_bits ; + //assert (BITS_PER_SLOT == 0 || BITS_PER_SLOT == qf->metadata->bits_per_slot); + //assert(bits_per_slot > 1); +// #if BITS_PER_SLOT == 8 || BITS_PER_SLOT == 16 || BITS_PER_SLOT == 32 || BITS_PER_SLOT == 64 +// size = nblocks * sizeof(qfblock) + (64)*fixed_counter_size; +// #else +// size = nblocks * (sizeof(qfblock) + (SLOTS_PER_BLOCK * bits_per_slot / 8) + +// fixed_counter_size*8 + tag_bits*8 ); +// #endif +//printf("bits per slot =%lu,key remainder bits =%lu, fixed counter =%lu, tag_bits=%lu\n", +//bits_per_slot,key_remainder_bits,fixed_counter_size,tag_bits ); +size = nblocks * (sizeof(qfblock) + (8 * bits_per_slot )) ; + +qf->mem = (qfmem *)calloc(sizeof(qfmem), 1); + + if (mem) { + qf->metadata = (qfmetadata *)calloc(sizeof(qfmetadata), 1); + qf->metadata->mem=mem; + qf->metadata->size = size; + qf->metadata->seed = seed; + qf->metadata->nslots = num_slots; + qf->metadata->xnslots = qf->metadata->nslots + + 10*sqrt((double)qf->metadata->nslots); + qf->metadata->key_bits = key_bits; + qf->metadata->tag_bits = tag_bits; + qf->metadata->fixed_counter_size = fixed_counter_size; + qf->metadata->key_remainder_bits = key_remainder_bits; + qf->metadata->bits_per_slot = bits_per_slot; + + qf->metadata->range = qf->metadata->nslots; + qf->metadata->range <<= qf->metadata->key_remainder_bits; + qf->metadata->nblocks = (qf->metadata->xnslots + SLOTS_PER_BLOCK - 1) / + SLOTS_PER_BLOCK; + qf->metadata->nelts = 0; + qf->metadata->ndistinct_elts = 0; + qf->metadata->noccupied_slots = 0; + qf->metadata->maximum_occupied_slots=(uint64_t)((double)qf->metadata->xnslots *0.95); + qf->metadata->num_locks = (qf->metadata->xnslots/NUM_SLOTS_TO_LOCK)+2; + + qf->blocks = (qfblock *)calloc(size, 1); + + + } else { + + qf->mem->fd = open(path, O_RDWR | O_CREAT | O_TRUNC, S_IRWXU); + if (qf->mem->fd < 0) { + perror("Couldn't open file:\n"); + exit(EXIT_FAILURE); + } + + /* prashantpandey: Commenting out fallocate call to preallocate space for + * the file on disk because fallocate is not supported on MAC OS. Revisit + * it later. */ + // int ret; + // ret = fallocate(qf->mem->fd, 0, 0, size+sizeof(qfmetadata)); + // if (ret < 0) { + // perror("Couldn't fallocate file:\n"); + // exit(EXIT_FAILURE); + // } + + // allocate space for mmaped file + std::ofstream outputFile(path); + outputFile.seekp(size+sizeof(qfmetadata)); + outputFile<<0; + outputFile.close(); + + + + qf->metadata = (qfmetadata *)mmap(NULL, size+sizeof(qfmetadata), PROT_READ | + PROT_WRITE, MAP_SHARED, qf->mem->fd, 0); + qf->metadata->mem=mem; + qf->metadata->size = size; + qf->metadata->seed = seed; + qf->metadata->nslots = num_slots; + qf->metadata->xnslots = qf->metadata->nslots + + 10*sqrt((double)qf->metadata->nslots); + qf->metadata->key_bits = key_bits; + qf->metadata->tag_bits = tag_bits; + qf->metadata->fixed_counter_size = fixed_counter_size; + qf->metadata->key_remainder_bits = key_remainder_bits; + qf->metadata->bits_per_slot = bits_per_slot; + + qf->metadata->range = qf->metadata->nslots; + qf->metadata->range <<= qf->metadata->key_remainder_bits; + qf->metadata->nblocks = (qf->metadata->xnslots + SLOTS_PER_BLOCK - 1) / + SLOTS_PER_BLOCK; + qf->metadata->nelts = 0; + qf->metadata->ndistinct_elts = 0; + qf->metadata->noccupied_slots = 0; + qf->metadata->maximum_occupied_slots=(uint64_t)((double)qf->metadata->xnslots *0.95); + qf->metadata->num_locks = (qf->metadata->xnslots/NUM_SLOTS_TO_LOCK)+2; + + qf->blocks = (qfblock *)(qf->metadata + 1); + } + + /* initialize all the locks to 0 */ + qf->mem->metadata_lock = 0; + qf->mem->locks = (volatile int *)calloc(qf->metadata->num_locks, + sizeof(volatile int)); + + +#ifdef LOG_WAIT_TIME + qf->mem->wait_times = (wait_time_data* )calloc(qf->metadata->num_locks+1, + sizeof(wait_time_data)); +#endif +} + +/* The caller should call qf_init on the dest QF before calling this function. + */ +void qf_copy(QF *dest, QF *src) +{ + memcpy(dest->mem, src->mem, sizeof(qfmem)); + memcpy(dest->metadata, src->metadata, sizeof(qfmetadata)); + memcpy(dest->blocks, src->blocks, src->metadata->size); +} + +/* free up the memory if the QF is in memory. + * else unmap the mapped memory from pagecache. + * + * It does not delete the file on disk for on-disk QF. + */ +void qf_destroy(QF *qf) +{ + assert(qf->blocks != NULL); + if (qf->metadata->mem) { + free(qf->mem); + free(qf->metadata); + free(qf->blocks); + } else { + msync(qf->metadata, qf->metadata->size + sizeof(qfmetadata),MS_SYNC); + munmap(qf->metadata, qf->metadata->size + sizeof(qfmetadata)); + close(qf->mem->fd); + } + //qf->metadata->noccupied_slots=0; +} + +void qf_close(QF *qf) +{ + assert(qf->blocks != NULL); + munmap(qf->metadata, qf->metadata->size + sizeof(qfmetadata)); + close(qf->mem->fd); +} + +/* + * Will read the on-disk QF using mmap. + * Data won't be copied in memory. + * + */ +void qf_read(QF *qf, const char *path) +{ + struct stat sb; + int ret; + + qf->mem = (qfmem *)calloc(sizeof(qfmem), 1); + qf->mem->fd = open(path, O_RDWR, S_IRWXU); + if (qf->mem->fd < 0) { + perror("Couldn't open file:\n"); + exit(EXIT_FAILURE); + } + + ret = fstat (qf->mem->fd, &sb); + if ( ret < 0) { + perror ("fstat"); + exit(EXIT_FAILURE); + } + + if (!S_ISREG (sb.st_mode)) { + fprintf (stderr, "%s is not a file\n", path); + exit(EXIT_FAILURE); + } + + qf->metadata = (qfmetadata *)mmap(NULL, sb.st_size, PROT_READ | PROT_WRITE, MAP_SHARED, + qf->mem->fd, 0); + qf->metadata->mem=false; + qf->blocks = (qfblock *)(qf->metadata + 1); + qf->metadata->num_locks = (qf->metadata->xnslots/NUM_SLOTS_TO_LOCK)+2; + qf->mem->metadata_lock = 0; + qf->mem->locks = (volatile int *)calloc(qf->metadata->num_locks, + sizeof(volatile int)); +} + +void qf_reset(QF *qf) +{ + assert(popcnt(nslots) == 1); /* nslots must be a power of 2 */ + + qf->metadata->nelts = 0; + qf->metadata->ndistinct_elts = 0; + qf->metadata->noccupied_slots = 0; + +#ifdef LOG_WAIT_TIME + memset(qf->wait_times, 0, (qf->metadata->num_locks+1)*sizeof(wait_time_data)); +#endif +#if BITS_PER_SLOT == 8 || BITS_PER_SLOT == 16 || BITS_PER_SLOT == 32 || BITS_PER_SLOT == 64 + memset(qf->blocks, 0, qf->metadata->nblocks* sizeof(qfblock)); +#else + memset(qf->blocks, 0, qf->metadata->nblocks*(sizeof(qfblock) + SLOTS_PER_BLOCK * + qf->metadata->bits_per_slot / 8)); +#endif +} + +void qf_serialize(const QF *qf, const char *filename) +{ + FILE *fout; + fout = fopen(filename, "wb+"); + if (fout == NULL) { + perror("Error opening file for serializing\n"); + exit(EXIT_FAILURE); + } + + fwrite(qf->metadata, sizeof(qfmetadata), 1, fout); + + /* we don't serialize the locks */ + fwrite(qf->blocks, qf->metadata->size, 1, fout); + + fclose(fout); +} + +void qf_deserialize(QF *qf, const char *filename) +{ + FILE *fin; + fin = fopen(filename, "rb"); + if (fin == NULL) { + perror("Error opening file for deserializing\n"); + exit(EXIT_FAILURE); + } + + qf->mem = (qfmem *)calloc(sizeof(qfmem), 1); + qf->metadata = (qfmetadata *)calloc(sizeof(qfmetadata), 1); + + fread(qf->metadata, sizeof(qfmetadata), 1, fin); + + /* initlialize the locks in the QF */ + qf->metadata->num_locks = (qf->metadata->xnslots/NUM_SLOTS_TO_LOCK)+2; + qf->mem->metadata_lock = 0; + /* initialize all the locks to 0 */ + qf->mem->locks = (volatile int *)calloc(qf->metadata->num_locks, sizeof(volatile int)); + + qf->blocks = (qfblock *)calloc(qf->metadata->size, 1); + fread(qf->blocks, qf->metadata->size, 1, fin); + + fclose(fin); +} +uint64_t qf_add_tag(const QF *qf, uint64_t key, uint64_t tag, bool lock, bool spin) +{ + __uint128_t hash = key; + uint64_t hash_remainder = hash & BITMASK(qf->metadata->key_remainder_bits); + int64_t hash_bucket_index = hash >> qf->metadata->key_remainder_bits; + + + if (!is_occupied(qf, hash_bucket_index)){ + return 0; + } + + int64_t runstart_index = hash_bucket_index == 0 ? 0 : run_end(qf, + hash_bucket_index-1) + + 1; + + if (runstart_index < hash_bucket_index) + runstart_index = hash_bucket_index; + + /* printf("MC RUNSTART: %02lx RUNEND: %02lx\n", runstart_index, runend_index); */ + + uint64_t current_remainder, current_count, current_end; + do { + current_end = decode_counter(qf, runstart_index, ¤t_remainder, + ¤t_count); + if (current_remainder == hash_remainder){ + if (lock) { + if (!qf_lock(qf, runstart_index, spin, false)) + return 0; + } + + set_tag(qf,runstart_index,tag); + if (lock) { + qf_unlock(qf, runstart_index, true); + } + + + return 1; + } + runstart_index = current_end + 1; + } while (!is_runend(qf, current_end)); + + + return 0; +} + +uint64_t qf_remove_tag(const QF *qf, uint64_t key ,bool lock, bool spin) +{ + __uint128_t hash = key; + uint64_t hash_remainder = hash & BITMASK(qf->metadata->key_remainder_bits); + int64_t hash_bucket_index = hash >> qf->metadata->key_remainder_bits; + if(hash_bucket_index > qf->metadata->xnslots){ + throw std::out_of_range("qf_remove_tag is called with hash index out of range"); + } + + if (!is_occupied(qf, hash_bucket_index)){ + return 0; + } + int64_t runstart_index = hash_bucket_index == 0 ? 0 : run_end(qf, + hash_bucket_index-1) + + 1; + if (runstart_index < hash_bucket_index) + runstart_index = hash_bucket_index; + + /* printf("MC RUNSTART: %02lx RUNEND: %02lx\n", runstart_index, runend_index); */ + + uint64_t current_remainder, current_count, current_end; + do { + current_end = decode_counter(qf, runstart_index, ¤t_remainder, + ¤t_count); + if (current_remainder == hash_remainder){ + if (lock) { + if (!qf_lock(qf, runstart_index, spin, false)) + return false; + } + set_tag(qf,runstart_index,0); + if (lock) + qf_unlock(qf, runstart_index, true); + return 1; + } + runstart_index = current_end + 1; + } while (!is_runend(qf, current_end)); + + + return 0; +} + +uint64_t qf_get_tag(const QF *qf, uint64_t key) +{ + __uint128_t hash = key; + uint64_t hash_remainder = hash & BITMASK(qf->metadata->key_remainder_bits); + int64_t hash_bucket_index = hash >> qf->metadata->key_remainder_bits; + if(hash_bucket_index > qf->metadata->xnslots){ + throw std::out_of_range("qf_get_tag is called with hash index out of range"); + } + if (!is_occupied(qf, hash_bucket_index)) + return 0; + + int64_t runstart_index = hash_bucket_index == 0 ? 0 : run_end(qf, + hash_bucket_index-1) + + 1; + if (runstart_index < hash_bucket_index) + runstart_index = hash_bucket_index; + + /* printf("MC RUNSTART: %02lx RUNEND: %02lx\n", runstart_index, runend_index); */ + + uint64_t current_remainder, current_count, current_end; + do { + current_end = decode_counter(qf, runstart_index, ¤t_remainder, + ¤t_count); + if (current_remainder == hash_remainder){ + return get_tag(qf,runstart_index); + } + runstart_index = current_end + 1; + } while (!is_runend(qf, current_end)); + + return 0; +} + + +bool qf_insert(QF *qf, uint64_t key, uint64_t count, bool + lock, bool spin) +{ + if(count==0) + { + return true; + } + /*uint64_t hash = (key << qf->metadata->tag_bits) | (value & BITMASK(qf->metadata->tag_bits));*/ + if (0 && count == 1) + return insert(qf, key,count, lock, spin); + else + return insert(qf, key, count, lock, spin); +} + +uint64_t qf_count_key(const QF *qf, uint64_t key) +{ + __uint128_t hash = key; + uint64_t hash_remainder = hash & BITMASK(qf->metadata->key_remainder_bits); + int64_t hash_bucket_index = hash >> qf->metadata->key_remainder_bits; + + if (!is_occupied(qf, hash_bucket_index)) + return 0; + + int64_t runstart_index = hash_bucket_index == 0 ? 0 : run_end(qf, + hash_bucket_index-1) + + 1; + if (runstart_index < hash_bucket_index) + runstart_index = hash_bucket_index; + + /* printf("MC RUNSTART: %02lx RUNEND: %02lx\n", runstart_index, runend_index); */ + + uint64_t current_remainder, current_count, current_end; + do { + current_end = decode_counter(qf, runstart_index, ¤t_remainder, + ¤t_count); + if (current_remainder == hash_remainder){ + return current_count; + } + + runstart_index = current_end + 1; + } while (!is_runend(qf, current_end)); + return 0; +} + + + + +/* initialize the iterator at the run corresponding + * to the position index + */ +bool qf_iterator(QF *qf, QFi *qfi, uint64_t position) +{ + if(position > qf->metadata->xnslots){ + throw std::out_of_range("qf_iterator is called with position out of range"); + } + if (!is_occupied(qf, position)) { + uint64_t block_index = position; + uint64_t idx = bitselect(get_block(qf, block_index)->occupieds[0], 0); + if (idx == 64) { + while(idx == 64 && block_index < qf->metadata->nblocks) { + block_index++; + idx = bitselect(get_block(qf, block_index)->occupieds[0], 0); + } + } + position = block_index * SLOTS_PER_BLOCK + idx; + } + + qfi->qf = qf; + qfi->num_clusters = 0; + qfi->run = position; + qfi->current = position == 0 ? 0 : run_end(qfi->qf, position-1) + 1; + if (qfi->current < position) + qfi->current = position; + +#ifdef LOG_CLUSTER_LENGTH + qfi->c_info = (cluster_data* )calloc(qf->metadata->nslots/32, sizeof(cluster_data)); + qfi->cur_start_index = position; + qfi->cur_length = 1; +#endif + + if (qfi->current >= qf->metadata->nslots) + return false; + return true; +} + +int qfi_get(QFi *qfi, uint64_t *key, uint64_t *value, uint64_t *count) +{ + + if(qfi->current > qfi->qf->metadata->xnslots){ + throw std::out_of_range("qfi_get is called with hash index out of range"); + } + uint64_t current_remainder, current_count; + decode_counter(qfi->qf, qfi->current, ¤t_remainder, ¤t_count); + *key = (qfi->run << qfi->qf->metadata->key_remainder_bits) | current_remainder; + *value = get_tag(qfi->qf,qfi->current); // for now we are not using value + *count = current_count; + + qfi->qf->metadata->ndistinct_elts++; + qfi->qf->metadata->nelts += current_count; + + /*qfi->current = end_index;*/ //get should not change the current index + //of the iterator + return 0; +} + +int qfi_next(QFi *qfi) +{ + if (qfi_end(qfi)) + return 1; + else { + /* move to the end of the current counter*/ + uint64_t current_remainder, current_count; + qfi->current = decode_counter(qfi->qf, qfi->current, ¤t_remainder, + ¤t_count); + + if (!is_runend(qfi->qf, qfi->current)) { + qfi->current++; +#ifdef LOG_CLUSTER_LENGTH + qfi->cur_length++; +#endif + if (qfi->current > qfi->qf->metadata->xnslots) + return 1; + return 0; + } + else { +#ifdef LOG_CLUSTER_LENGTH + /* save to check if the new current is the new cluster. */ + uint64_t old_current = qfi->current; +#endif + uint64_t block_index = qfi->run / SLOTS_PER_BLOCK; + uint64_t rank = bitrank(get_block(qfi->qf, block_index)->occupieds[0], + qfi->run % SLOTS_PER_BLOCK); + uint64_t next_run = bitselect(get_block(qfi->qf, + block_index)->occupieds[0], + rank); + if (next_run == 64) { + rank = 0; + while (next_run == 64 && block_index < qfi->qf->metadata->nblocks) { + block_index++; + next_run = bitselect(get_block(qfi->qf, block_index)->occupieds[0], + rank); + } + } + if (block_index == qfi->qf->metadata->nblocks) { + /* set the index values to max. */ + qfi->run = qfi->current = qfi->qf->metadata->xnslots; + return 1; + } + qfi->run = block_index * SLOTS_PER_BLOCK + next_run; + qfi->current++; + if (qfi->current < qfi->run) + qfi->current = qfi->run; +#ifdef LOG_CLUSTER_LENGTH + if (qfi->current > old_current + 1) { /* new cluster. */ + if (qfi->cur_length > 10) { + qfi->c_info[qfi->num_clusters].start_index = qfi->cur_start_index; + qfi->c_info[qfi->num_clusters].length = qfi->cur_length; + qfi->num_clusters++; + } + qfi->cur_start_index = qfi->run; + qfi->cur_length = 1; + } else { + qfi->cur_length++; + } +#endif + return 0; + } + } +} + +inline int qfi_end(QFi *qfi) +{ + if (qfi->current >= qfi->qf->metadata->xnslots /*&& is_runend(qfi->qf, qfi->current)*/) + return 1; + else + return 0; +} + +/* + * Merge qfa and qfb into qfc + */ +/* + * iterate over both qf (qfa and qfb) + * simultaneously + * for each index i + * min(get_value(qfa, ia) < get_value(qfb, ib)) + * insert(min, ic) + * increment either ia or ib, whichever is minimum. + */ +void qf_merge(QF *qfa, QF *qfb, QF *qfc) +{ + QFi qfia, qfib; + if(qfa->metadata->range != qfb->metadata->range || + qfb->metadata->range != qfc->metadata->range ) + { + throw std::logic_error("Merging non compatible filters"); + } + qf_iterator(qfa, &qfia, 0); + qf_iterator(qfb, &qfib, 0); + + uint64_t keya, valuea, counta, keyb, valueb, countb; + qfi_get(&qfia, &keya, &valuea, &counta); + qfi_get(&qfib, &keyb, &valueb, &countb); + do { + if (keya < keyb) { + qf_insert(qfc, keya, counta, true, true); + qfi_next(&qfia); + qfi_get(&qfia, &keya, &valuea, &counta); + } + else { + qf_insert(qfc, keyb, countb, true, true); + qfi_next(&qfib); + qfi_get(&qfib, &keyb, &valueb, &countb); + } + } while(!qfi_end(&qfia) && !qfi_end(&qfib)); + + if (!qfi_end(&qfia)) { + do { + qfi_get(&qfia, &keya, &valuea, &counta); + qf_insert(qfc, keya, counta, true, true); + } while(!qfi_next(&qfia)); + } + if (!qfi_end(&qfib)) { + do { + qfi_get(&qfib, &keyb, &valueb, &countb); + qf_insert(qfc, keyb, countb, true, true); + } while(!qfi_next(&qfib)); + } + + return; +} + +bool qf_equals(QF *qfa, QF *qfb) +{ + QFi qfia, qfib; + if(qfa->metadata->range != qfb->metadata->range ) + { + throw std::logic_error("comparing non compatible filters"); + } + qf_iterator(qfa, &qfia, 0); + qf_iterator(qfb, &qfib, 0); + + uint64_t keya, valuea, counta, keyb, valueb, countb; + qfi_get(&qfia, &keya, &valuea, &counta); + qfi_get(&qfib, &keyb, &valueb, &countb); + do { + if (keya != keyb) { + return false; + } + else { + if(counta!=countb || valuea != valueb) + { + return false; + } + qfi_next(&qfib); + qfi_next(&qfia); + qfi_get(&qfia, &keya, &valuea, &counta); + qfi_get(&qfib, &keyb, &valueb, &countb); + } + } while(!qfi_end(&qfia) && !qfi_end(&qfib)); + + if (!qfi_end(&qfia) || !qfi_end(&qfib)) { + return false; + } + + return true; +} + +void qf_intersect(QF *qfa, QF *qfb, QF *qfc) +{ + QFi qfia, qfib; + if(qfa->metadata->range != qfb->metadata->range || + qfb->metadata->range != qfc->metadata->range ) + { + throw std::logic_error("Calculate intersect for non compatible filters"); + } + qf_iterator(qfa, &qfia, 0); + qf_iterator(qfb, &qfib, 0); + + uint64_t keya, valuea, counta, keyb, valueb, countb; + qfi_get(&qfia, &keya, &valuea, &counta); + qfi_get(&qfib, &keyb, &valueb, &countb); + do { + if (keya < keyb) { + qfi_next(&qfia); + qfi_get(&qfia, &keya, &valuea, &counta); + } + else if(keyb < keya) { + qfi_next(&qfib); + qfi_get(&qfib, &keyb, &valueb, &countb); + } + else{ + qf_insert(qfc, keya, std::min(counta,countb), true, true); + qfi_next(&qfia); + qfi_next(&qfib); + qfi_get(&qfia, &keya, &valuea, &counta); + qfi_get(&qfib, &keyb, &valueb, &countb); + } + } while(!qfi_end(&qfia) && !qfi_end(&qfib)); + + + + return; +} +void qf_subtract(QF *qfa, QF *qfb, QF *qfc) +{ + QFi qfia, qfib; + if(qfa->metadata->range != qfb->metadata->range || + qfb->metadata->range != qfc->metadata->range ) + { + throw std::logic_error("Calculate subtracte for non compatible filters"); + } + qf_iterator(qfa, &qfia, 0); + qf_iterator(qfb, &qfib, 0); + + uint64_t keya, valuea, counta, keyb, valueb, countb; + qfi_get(&qfia, &keya, &valuea, &counta); + qfi_get(&qfib, &keyb, &valueb, &countb); + do { + if (keya < keyb) { + qfi_next(&qfia); + qfi_get(&qfia, &keya, &valuea, &counta); + } + else if(keyb < keya) { + qfi_next(&qfib); + qfi_get(&qfib, &keyb, &valueb, &countb); + } + else{ + qf_insert(qfc, keya, counta>countb? counta-countb : 0, true, true); + qfi_next(&qfia); + qfi_next(&qfib); + qfi_get(&qfia, &keya, &valuea, &counta); + qfi_get(&qfib, &keyb, &valueb, &countb); + } + } while(!qfi_end(&qfia) && !qfi_end(&qfib)); + + return; +} + + + +/* + * Merge an array of qfs into the resultant QF + */ +void qf_multi_merge(QF *qf_arr[], int nqf, QF *qfr) +{ + int i; + QFi qfi_arr[nqf]; + int flag = 0; + int smallest_i = 0; + uint64_t smallest_key = UINT64_MAX; + + uint64_t range=qf_arr[0]->metadata->range; + for (i=1; imetadata->range!=range) + { + throw std::logic_error("Merging non compatible filters"); + } + } + + for (i=0; imetadata->key_bits-newQ <2) + { + throw std::logic_error("Resize cannot be done. Slot size cannot be less than 2"); + } + + if(originalFilename) + { + qf_serialize(qf,originalFilename); + qf_destroy(qf); + qf_read(qf,originalFilename); + } + QF* newQF=(QF *)calloc(sizeof(QF), 1); + if(newFilename) + { + qf_init(newQF, (1ULL<metadata->key_bits, qf->metadata->tag_bits,qf->metadata->fixed_counter_size, false, newFilename, 2038074761); + } + else{ + qf_init(newQF, (1ULL<metadata->key_bits, qf->metadata->tag_bits,qf->metadata->fixed_counter_size, true, "" , 2038074761); + } + QFi qfi; + qf_iterator(qf, &qfi, 0); + + + uint64_t keya, valuea, counta; + qfi_get(&qfi, &keya, &valuea, &counta); + + do { + qf_insert(newQF, keya, counta); + qf_add_tag(newQF,keya,valuea); + qfi_next(&qfi); + qfi_get(&qfi, &keya, &valuea, &counta); + } while(!qfi_end(&qfi)); + qf_destroy(qf); + return newQF; + + +} + +/* find cosine similarity between two QFs. */ +uint64_t qf_inner_product(QF *qfa, QF *qfb) +{ + uint64_t acc = 0; + QFi qfi; + QF *qf_mem, *qf_disk; + + // create the iterator on the larger QF. + if (qfa->metadata->size > qfb->metadata->size) { + qf_mem = qfb; + qf_disk = qfa; + } else { + qf_mem = qfa; + qf_disk = qfb; + } + + qf_iterator(qf_disk, &qfi, 0); + do { + uint64_t key = 0, value = 0, count = 0; + uint64_t count_mem; + qfi_get(&qfi, &key, &value, &count); + if ((count_mem = qf_count_key(qf_mem, key)) > 0) { + acc += count*count_mem; + } + } while (!qfi_next(&qfi)); + + return acc; +} + +/* find cosine similarity between two QFs. */ +// void qf_intersect(QF *qfa, QF *qfb, QF *qfr) +// { +// QFi qfi; +// QF *qf_mem, *qf_disk; +// +// // create the iterator on the larger QF. +// if (qfa->metadata->size > qfb->metadata->size) { +// qf_mem = qfb; +// qf_disk = qfa; +// } else { +// qf_mem = qfa; +// qf_disk = qfb; +// } +// +// qf_iterator(qf_disk, &qfi, 0); +// do { +// uint64_t key = 0, value = 0, count = 0; +// qfi_get(&qfi, &key, &value, &count); +// if (qf_count_key(qf_mem, key) > 0) +// qf_insert(qfr, key, count, false, false); +// } while (!qfi_next(&qfi)); +// } + +/* magnitude of a QF. */ +uint64_t qf_magnitude(QF *qf) +{ + return sqrt(qf_inner_product(qf, qf)); +} + + +int qf_space(QF *qf) +{ + return (int)(((double)qf->metadata->noccupied_slots/ + (double)qf->metadata->xnslots + )* 100.0); +} + +#ifdef TEST + #include "tests/lowLevelTests.hpp" +#endif +//} diff --git a/third-party/mqf/gqf.hh b/third-party/mqf/gqf.hh new file mode 100644 index 0000000000..c1b1ba382d --- /dev/null +++ b/third-party/mqf/gqf.hh @@ -0,0 +1,253 @@ +#ifndef QF_H +#define QF_H + +#include +#include +#include + +// extern "C" { + +/* Can be + 0 (choose size at run-time), + 8, 16, 32, or 64 (for optimized versions), + or other integer <= 56 (for compile-time-optimized bit-shifting-based versions) + */ +#define BITS_PER_SLOT 0 + + struct __attribute__ ((__packed__)) qfblock; + typedef struct qfblock qfblock; + + uint64_t shift_into_b2(uint64_t a, uint64_t b, int bstart, int bend, int amount); + + typedef struct { + uint64_t total_time_single; + uint64_t total_time_spinning; + uint64_t locks_taken; + uint64_t locks_acquired_single_attempt; + } wait_time_data; + + typedef struct quotient_filter_mem { + int fd; + volatile int metadata_lock; + volatile int *locks; + wait_time_data *wait_times; + } quotient_filter_mem; + + typedef quotient_filter_mem qfmem; + + typedef struct quotient_filter_metadata { + uint64_t size; + uint32_t seed; + uint64_t nslots; + uint64_t xnslots; + uint64_t key_bits; + uint64_t tag_bits; + uint64_t fixed_counter_size; + uint64_t key_remainder_bits; + uint64_t bits_per_slot; + __uint128_t range; + uint64_t nblocks; + uint64_t nelts; + uint64_t ndistinct_elts; + uint64_t noccupied_slots; + uint64_t maximum_occupied_slots; + uint64_t num_locks; + bool mem; + } quotient_filter_metadata; + + typedef quotient_filter_metadata qfmetadata; + + typedef struct quotient_filter { + qfmem *mem; + qfmetadata *metadata; + qfblock *blocks; + } quotient_filter; + + typedef quotient_filter QF; + + typedef struct { + uint64_t start_index; + uint16_t length; + } cluster_data; + + typedef struct quotient_filter_iterator { + QF *qf; + uint64_t run; + uint64_t current; + uint64_t cur_start_index; + uint16_t cur_length; + uint32_t num_clusters; + cluster_data *c_info; + } quotient_filter_iterator; + + typedef quotient_filter_iterator QFi; + + /*! + @breif initialize mqf . + + @param Qf* qf : pointer to the Filter. + @param uint64_t nslots : Number of slots in the filter. Maximum number of items to be inserted depends on this number. + @param uint64_t key_bits: Number of bits in the hash values. This number should equal log2(nslots) +r. Accuracy depends on r. + @param uint64_t tag_bits: Number of bits in tag value. + @param uint64_t fixed_counter_size: Fixed counter size. must be > 0. + @param bool mem: Flag to create the filter on memeory. IF false, mmap is used. + @param const char * path: In case of mmap. Path of the file used to pack the filter. + @param uint32_t seed: useless value. To be removed + */ + void qf_init(QF *qf, uint64_t nslots, uint64_t key_bits, uint64_t tag_bits,uint64_t fixed_counter_size, bool mem, const char *path, uint32_t seed); + + void qf_reset(QF *qf); + + void qf_destroy(QF *qf); + + void qf_copy(QF *dest, QF *src); + + /*! + @breif Increment the counter for this item by count. + + @param Qf* qf : pointer to the Filter + @param uint64_t key : hash of the item to be insertedItems + @param uint64_t count: Count to be added + @param bool lock: For Multithreading, Lock the slot used by the current thread so that other threads can't change the value + @param bool spin: For Multithreading, If there is a lock on the target slot. wait until the lock is freed and insert the count. + + @return bool: True if the item is inserted correctly. + */ + bool qf_insert(QF *qf, uint64_t key, uint64_t count, + bool lock=false, bool spin=false); + + + /* Remove all instances of this key/value pair. */ + //void qf_delete_key_value(QF *qf, uint64_t key, uint64_t value); + + /* Remove all instances of this key. */ + //void qf_delete_key(QF *qf, uint64_t key); + + /* Replace the association (key, oldvalue, count) with the association + (key, newvalue, count). If there is already an association (key, + newvalue, count'), then the two associations will be merged and + their counters will be summed, resulting in association (key, + newvalue, count' + count). */ + void qf_replace(QF *qf, uint64_t key, uint64_t oldvalue, uint64_t newvalue); + + /* Lookup the value associated with key. Returns the count of that + key/value pair in the QF. If it returns 0, then, the key is not + present in the QF. Only returns the first value associated with key + in the QF. If you want to see others, use an iterator. */ + uint64_t qf_query(const QF *qf, uint64_t key, uint64_t *value); + + /*! + @breif Return the number of times key has been inserted, with any value, + into qf. + + @param Qf* qf : pointer to the Filter. + @param uint64_t key : hash of the item. + + @return uint64_t the count associated with the input key. + */ + uint64_t qf_count_key(const QF *qf, uint64_t key); + + /*! + @breif Decrement the counter for this item by count. + + @param Qf* qf : pointer to the Filter + @param uint64_t key : hash of the item to be removed + @param uint64_t count: Count to be removed + @param bool lock: For Multithreading, Lock the slot used by the current thread so that other threads can't change the value + @param bool spin: For Multithreading, If there is a lock on the target slot. wait until the lock is freed and insert the count. + + @return bool: Returns true if the item is removed successfully. + */ + bool qf_remove(QF *qf, uint64_t hash, uint64_t count, bool lock=false, bool spin=false); + + + /*! + @breif Add Tag to item. + + @param Qf* qf : pointer to the Filter + @param uint64_t key : hash of the item to be insertedItems + @param uint64_t tag: tag to be added + @param bool lock: For Multithreading, Lock the slot used by the current thread so that other threads can't change the value + @param bool spin: For Multithreading, If there is a lock on the target slot. wait until the lock is freed and insert the count. + + @return bool: True if the item is inserted correctly. + */ + uint64_t qf_add_tag(const QF *qf, uint64_t key, uint64_t tag, bool lock=false, bool spin=false); + /*! + @breif Return the tag associated with a given item. + + @param Qf* qf : pointer to the Filter. + @param uint64_t key : hash of the item. + + @return uint64_t the tag associated with the input key. + */ + uint64_t qf_get_tag(const QF *qf, uint64_t key); + /*! + @breif delete the tag associated with a given item. + + @param Qf* qf : pointer to the Filter. + @param uint64_t key : hash of the item. + + @return bool: Returns true if the item is removed successfully. + */ + uint64_t qf_remove_tag(const QF *qf, uint64_t key, bool lock=false, bool spin=false); + + /* Initialize an iterator */ + bool qf_iterator(QF *qf, QFi *qfi, uint64_t position); + + /* Returns 0 if the iterator is still valid (i.e. has not reached the + end of the QF. */ + int qfi_get(QFi *qfi, uint64_t *key, uint64_t *value, uint64_t *count); + + /* Advance to next entry. Returns whether or not another entry is + found. */ + int qfi_next(QFi *qfi); + + /* Check to see if the if the end of the QF */ + int qfi_end(QFi *qfi); + + /* For debugging */ + void qf_dump(const QF *); + + /*! write data structure of to the disk */ + void qf_serialize(const QF *qf, const char *filename); + + /* read data structure off the disk */ + void qf_deserialize(QF *qf, const char *filename); + + /* mmap the QF from disk. */ + void qf_read(QF *qf, const char *path); + + /* merge two QFs into the third one. */ + void qf_merge(QF *qfa, QF *qfb, QF *qfc); + + void qf_intersect(QF *qfa, QF *qfb, QF *qfc); + + void qf_subtract(QF *qfa, QF *qfb, QF *qfc); + /* merge multiple QFs into the final QF one. */ + void qf_multi_merge(QF *qf_arr[], int nqf, QF *qfr); + + /*! @breif Resize the filter into a bigger or smaller one + + @param Qf* qf : pointer to the Filter + @param uint64_t newQ: new number of slots(Q). the slot size will be recalculated to keep the range constant. + @param string originalFilename(optional): dump the current filter to the disk to free space for the new filter. Filename is provided as the content of the string. + @param string newFilename(optional): the new filter is created on disk. Filename is provided as the content of the string. + + @return QF: New Quotient Filter. + */ + QF* qf_resize(QF* qf, int newQ, const char * originalFilename=NULL, const char * newFilename=NULL); + /* find cosine similarity between two QFs. */ + uint64_t qf_inner_product(QF *qfa, QF *qfb); + + /* magnitude of a QF. */ + uint64_t qf_magnitude(QF *qf); + /* return the filled space(percent) */ + int qf_space(QF *qf); + + bool qf_equals(QF *qfa, QF *qfb); + + +// } +#endif /* QF_H */ +