Have run the test packaged with the software successfully. But when I try to run my own data, I get the following error:
python create_inference_graphs.py --reads All+RatQ3.fastq --gfa raven-unpolished.gfa --asm raven --out Assembly
Starting to parse assembler output
Starting to loop over GFA
Traceback (most recent call last):
File "create_inference_graphs.py", line 50, in
create_inference_graph(gfa, reads, out, asm)
File "create_inference_graphs.py", line 13, in create_inference_graph
graph, pred, succ, reads, edges, read_to_node, _ = graph_parser.only_from_gfa(gfa_path, training=False, reads_path=reads_path, get_similarities=True)
File "/home/jpummil/Applications/GNNome/graph_parser.py", line 165, in only_from_gfa
if sequence == '*':
UnboundLocalError: local variable 'sequence' referenced before assignment
The referenced .fastq file assembles fine using Raven. Line 165 as referenced begins as follows:
S f890dea9-4546-4e77-aaee-6d7924f1a07d CCGAGTGCCGCCTCTGGCACACGTGCCGTAGGTTCGCCACCACTGCTATA
Something obvious I'm doing incorrectly, or perhaps just an early code issue?
Have run the test packaged with the software successfully. But when I try to run my own data, I get the following error:
python create_inference_graphs.py --reads All+RatQ3.fastq --gfa raven-unpolished.gfa --asm raven --out Assembly
Starting to parse assembler output
Starting to loop over GFA
Traceback (most recent call last):
File "create_inference_graphs.py", line 50, in
create_inference_graph(gfa, reads, out, asm)
File "create_inference_graphs.py", line 13, in create_inference_graph
graph, pred, succ, reads, edges, read_to_node, _ = graph_parser.only_from_gfa(gfa_path, training=False, reads_path=reads_path, get_similarities=True)
File "/home/jpummil/Applications/GNNome/graph_parser.py", line 165, in only_from_gfa
if sequence == '*':
UnboundLocalError: local variable 'sequence' referenced before assignment
The referenced .fastq file assembles fine using Raven. Line 165 as referenced begins as follows:
S f890dea9-4546-4e77-aaee-6d7924f1a07d CCGAGTGCCGCCTCTGGCACACGTGCCGTAGGTTCGCCACCACTGCTATA
Something obvious I'm doing incorrectly, or perhaps just an early code issue?