Hi,
I have Arriba fusion caller results (run with Gencode v27 equivalent to Ensembl 90) and wanted to test the following out-of-frame fusion:
| #gene1 |
gene2 |
strand1(gene/fusion) |
strand2(gene/fusion) |
breakpoint1 |
breakpoint2 |
site1 |
site2 |
type |
direction1 |
direction2 |
split_reads1 |
split_reads2 |
discordant_mates |
coverage1 |
coverage2 |
confidence |
closest_genomic_breakpoint1 |
closest_genomic_breakpoint2 |
filters |
fusion_transcript |
reading_frame |
peptide_sequence |
read_identifiers |
sample_name |
| CHMP1A |
DPEP1 |
-/- |
+/- |
16:89651569 |
16:89625844 |
splice-site |
intron |
deletion/read-through/5'-5' |
upstream |
downstream |
7 |
6 |
1 |
118 |
36 |
high |
. |
. |
duplicates(4),low_entropy(1) |
GCTTGGTCGGTTCGATCGCCGCCGGGACCTGACACCGCCCGGAGTTGGCGTCCCTTCTCCCTCTCCGAGTGCTGCTCCTGTCATTGTGGCCATGGACG___ATACCCTGTTCCAGTTGAAG___TTCACGGCGAAGCAGCTGGAGAAGCTGGCCAAGAAGGCGGAGAAGGACTCCAAGGCGGAGCAGGCCAAAGTGAAGAAG|TCTCTTCGTCTGTCAAGTAGAAGTCATGGATGTACCTACTTTACGACAGTCCTGCTGTGAGCACAAAGGTACCAGCCACTCAGATCACCCTCGGATCAAG___CTCTGTCTCCCAGAACCACACAGAAGCCCCATCCACAGCCAACATGCAGACGCCACCGTGGCCATTTCGGATGATACCACTTCTGCACAGGCAGCCACAGGCAATGCGGACCTACCCACGCCCCCCACACACAGATCATCGCAG |
out-of-frame |
MDDTLFQLKFTAKQLEKLAKKAEKDSKAEQAKVKK|slrlssrshgctyfttvll* |
. |
0062396f-103a-4c25-bfdc-a746782768d9 |
I ran agfusion like this:
agfusion annotate \
--gene5prime CHMP1A \
--gene3prime DPEP1 \
--junction5prime 89651569 \
--junction3prime 89625844 \
-db agfusion.homo_sapiens.90.db \
-o CHMP1A-DPEP1
I got quite the opposite result from agfusion, predicting it to be an in-frame fusion:
$ cat CHMP1A-DPEP1.fusion_transcripts.txt
5'_gene,3'_gene,5'_transcript,3'_transcript,5'_strand,3'_strand,5'_transcript_biotype,3'_transcript_biotype,Fusion_effect,Protein_length,Protein_weight_(kD)
CHMP1A,DPEP1,ENST00000397901,ENST00000393092,-,+,protein_coding,protein_coding,in-frame,446,49.6940567
I am not sure why that is happening, any ideas/suggestions would be much appreciated.
Hi,
I have Arriba fusion caller results (run with Gencode v27 equivalent to Ensembl 90) and wanted to test the following
out-of-framefusion:I ran agfusion like this:
I got quite the opposite result from agfusion, predicting it to be an in-frame fusion:
I am not sure why that is happening, any ideas/suggestions would be much appreciated.