diff --git a/DIMPLE/DIMPLE.py b/DIMPLE/DIMPLE.py
index 8c1883f..51c4562 100644
--- a/DIMPLE/DIMPLE.py
+++ b/DIMPLE/DIMPLE.py
@@ -1121,7 +1121,13 @@ def generate_DMS_fragments(
                         for (
                             sequence
                         ) in dms_sequence_list:  # add barcodes to the fragments to make the oligos
-                            if insert or delete:
+                            # Per-sequence trim path is required whenever the list can hold
+                            # variable-length entries: insert/delete vary by definition; dis
+                            # inserts a handle so its sequences are longer than concurrent
+                            # DMS substitutions in the same list. The else-branch's blind
+                            # concat only stays at synth_len when every sequence matches the
+                            # smallest_frag the barcodes were sized for.
+                            if insert or delete or dis:
                                 cutsite_overhang = pool.config.cutsite_overhang
                                 difference = (
                                     pool.config.synth_len
diff --git a/tests/regression/test_dms_dis_combined_kir.py b/tests/regression/test_dms_dis_combined_kir.py
new file mode 100644
index 0000000..93e2857
--- /dev/null
+++ b/tests/regression/test_dms_dis_combined_kir.py
@@ -0,0 +1,83 @@
+"""Regression test: combined DMS + DIS scan on the Kir gene.
+
+Guards the bug where ``generate_DMS_fragments`` overflowed ``synth_len`` when
+both DMS and DIS were enabled. ``DMS`` and ``DIS`` push fragments into the
+same ``dms_sequences`` list per gene-fragment, but DIS fragments are
+``len(handle)`` longer than DMS substitutions. The barcode pair sized once
+from the smallest fragment got concatenated whole onto the longer DIS
+sequences, producing oligos `handle_len - 2*overhang` bytes over ``synth_len``::
+
+    Exception: Oligo too long: 246 is longer than 230
+
+Fixed by extending the per-sequence trim branch in the oligo-assembly loop
+to also fire when ``dis=True``. This test runs DMS+DIS and asserts the run
+completes, every oligo is at most ``synth_len`` long, and the
+``designed_variants`` table includes both mutation types.
+"""
+
+import shutil
+
+import pytest
+from Bio.Seq import Seq
+
+from DIMPLE.DIMPLE import addgene, generate_DMS_fragments
+from DIMPLE.pool import DimpleRuntimeConfig
+
+_HANDLE = "AGCGGGAGACCGGGGTCTCTGAGC"
+_OVERLAP = 3
+
+
+@pytest.mark.slow
+def test_dms_dis_combined_kir(tmp_path, dimple_human_usage, kir_fa):
+    """DMS+DIS together stays within synth_len for every emitted oligo."""
+    gene_file = tmp_path / kir_fa.name
+    shutil.copy(kir_fa, gene_file)
+    wDir = str(tmp_path) + "/"
+
+    config = DimpleRuntimeConfig(
+        handle=_HANDLE,
+        synth_len=230,
+        maxfrag=230 - 62 - _OVERLAP,
+        primer_buffer=30 + _OVERLAP,
+        dms=True,
+        stop_codon=False,
+        make_double=False,
+        maximize_nucleotide_change=False,
+        cutsite=Seq("CGTCTC"),
+        cutsite_buffer=Seq("G"),
+        cutsite_overhang=4,
+        enzyme=None,
+        # The handle carries a BsaI site; only avoid the BsmBI cassette site.
+        avoid_sequence=[Seq("CGTCTC")],
+        random_seed=1848,
+        usage=dimple_human_usage,
+    )
+
+    pool = addgene(str(gene_file), config)
+
+    generate_DMS_fragments(
+        pool,
+        _OVERLAP,
+        _OVERLAP,
+        False,  # synonymous
+        None,  # custom_mutations
+        True,  # dms
+        False,  # insert
+        False,  # delete
+        True,  # dis
+        wDir,
+    )
+
+    gene = pool[0]
+
+    # The crash being guarded: every emitted oligo must fit in synth_len.
+    overlong = [o for o in gene.oligos if len(o.seq) > config.synth_len]
+    assert not overlong, (
+        f"{len(overlong)} oligos exceed synth_len={config.synth_len}: "
+        f"max={max(len(o.seq) for o in overlong)}"
+    )
+
+    # Both mutation types should be represented in designed_variants.
+    types = {v["mutation_type"] for v in gene.designed_variants.values()}
+    assert "M" in types or "S" in types, f"no DMS substitution variants registered (types: {types})"
+    assert "DI" in types, f"no DI variants registered (types: {types})"