From 3be4d5653f29dd1f98e70e0c0f688e0ca1e76054 Mon Sep 17 00:00:00 2001 From: Leonhard Gruenschloss Date: Tue, 12 May 2026 10:21:26 +1000 Subject: [PATCH] feat: add k-mer-seeded top-k ungapped local alignment MIME-Version: 1.0 Content-Type: text/plain; charset=UTF-8 Content-Transfer-Encoding: 8bit `top_k_ungapped_local_align_kmer(seqa, seqb, score_matrix, k, kmer_size, max_hits_per_kmer, filter_overlap_a=True, filter_overlap_b=True)` is a faster alternative to `top_k_ungapped_local_align` for callers that work on long inputs over a moderate-sized alphabet. Algorithm: BLAST-style k-mer seeding plus the existing per-diagonal positive-segment scan as the extension. 1. Build a rolling-hash k-mer index of `seqa` (packed k-mer -> sa positions; `kmer_size` in `[1, 8]`, packed into a `u64`). 2. Walk `seqb`'s rolling k-mer; for each lookup, collect the set of hit diagonals (`diag = sa_pos - sb_pos`). Skip k-mers whose `seqa`-occurrence count exceeds `max_hits_per_kmer` to bound low-complexity blowup (long runs of spaces, common bigrams, etc.). 3. Run the per-diagonal positive-segment scan *only* on diagonals with at least one hit, into the same candidate heap. 4. Pop top-`k` non-overlapping via the existing overlap-filter logic. The output `Alignment` shape and overlap semantics are identical to `top_k_ungapped_local_align`, so the new function is a drop-in replacement at the seed step of any caller. Implementation reuses the existing diagonal scan by extracting two helpers out of `_top_k_ungapped_local_align_core`: - `process_diagonal_into_candidates`: SW-style positive-segment scan along one diagonal of (sb x sa), pushing every positive HSP peak into a `BinaryHeap`. - `select_top_k_with_overlap_filter`: pop top-`k` from the heap, skipping HSPs that overlap an already-accepted one on `A` and/or `B`. Both `_top_k_ungapped_local_align_core` and the new k-mer variant share these helpers. Behaviour-preserving refactor — all existing top-k tests pass unchanged. Correctness caveat (documented on the new function): an HSP is found iff at least one window of `kmer_size` consecutive exact-match bytes lies on its diagonal between the two sequences. HSPs whose match runs are all strictly shorter than `kmer_size` are missed. Over text-like alphabets at `kmer_size <= 5` this only happens at very small HSP scores; callers that need exhaustive coverage at the boundary should keep using `top_k_ungapped_local_align` or fall through to a full local SW (as `anchorite.chained_alignment`'s recursive gap-fill does). New tests in `tests/test_seq_smith.py`: - simple HSP recovery (matches the existing `test_top_k_ungapped_simple` case), - near-identity equivalence with the full-scan top-k on random DNA at the high end of the score distribution, - overlap filter on `B` (matches `test_top_k_ungapped_overlap`), - top-`k` limit (matches `test_top_k_ungapped_limit`), - `kmer_size` validation rejects 0 and 9+ with `ValueError`, - sequences shorter than `kmer_size` return `[]`, - `max_hits_per_kmer=0` returns `[]` even on a poly-A identity pair (the cap that protects against low-complexity blowup). --- seq_smith/__init__.py | 2 + seq_smith/_seq_smith.pyi | 10 ++ src/lib.rs | 341 ++++++++++++++++++++++++++++++--------- tests/test_seq_smith.py | 140 ++++++++++++++++ 4 files changed, 417 insertions(+), 76 deletions(-) diff --git a/seq_smith/__init__.py b/seq_smith/__init__.py index 1013c98..e4f6cf0 100644 --- a/seq_smith/__init__.py +++ b/seq_smith/__init__.py @@ -11,6 +11,7 @@ overlap_align, overlap_align_many, top_k_ungapped_local_align, + top_k_ungapped_local_align_kmer, top_k_ungapped_local_align_many, ) from .python_utils import decode, encode, format_alignment_ascii, generate_cigar, make_score_matrix @@ -33,5 +34,6 @@ "overlap_align", "overlap_align_many", "top_k_ungapped_local_align", + "top_k_ungapped_local_align_kmer", "top_k_ungapped_local_align_many", ] diff --git a/seq_smith/_seq_smith.pyi b/seq_smith/_seq_smith.pyi index 64cd598..818098e 100644 --- a/seq_smith/_seq_smith.pyi +++ b/seq_smith/_seq_smith.pyi @@ -125,6 +125,16 @@ def top_k_ungapped_local_align( filter_overlap_a: bool = True, filter_overlap_b: bool = True, ) -> list[Alignment]: ... +def top_k_ungapped_local_align_kmer( + seqa: bytes, + seqb: bytes, + score_matrix: npt.NDArray[np.int32], + k: int, + kmer_size: int, + max_hits_per_kmer: int, + filter_overlap_a: bool = True, + filter_overlap_b: bool = True, +) -> list[Alignment]: ... def top_k_ungapped_local_align_many( seqa: bytes, seqbs: Sequence[bytes], diff --git a/src/lib.rs b/src/lib.rs index 81a1627..f769912 100644 --- a/src/lib.rs +++ b/src/lib.rs @@ -6,7 +6,7 @@ use pyo3::wrap_pyfunction; use pyo3_stub_gen::{define_stub_info_gatherer, derive::*}; use rayon::prelude::*; use std::cmp::Ordering; -use std::collections::BinaryHeap; +use std::collections::{BinaryHeap, HashMap, HashSet}; /// Represents the type of an alignment fragment. #[gen_stub_pyclass_enum] @@ -1008,85 +1008,88 @@ impl PartialOrd for Candidate { } } -fn _top_k_ungapped_local_align_core( - params: UngappedAlignmentParams, - k: usize, - filter_overlap_a: bool, - filter_overlap_b: bool, -) -> PyResult> { - let sa_len = params.sa.len(); - let sb_len = params.sb.len(); - - let mut candidates: BinaryHeap = BinaryHeap::new(); +#[inline] +fn push_candidate( + candidates: &mut BinaryHeap, + score: i32, + sa_start: usize, + sb_start: usize, + len: usize, +) { + if score > 0 { + candidates.push(Candidate { + score, + sa_start, + sb_start, + len, + }); + } +} - let mut add_candidate = |score: i32, sa_start: usize, sb_start: usize, len: usize| { - if score > 0 { - candidates.push(Candidate { - score, - sa_start, - sb_start, - len, - }); +// Smith-Waterman-style positive-segment scan along a single diagonal of the +// (sb x sa) grid, pushing every positive HSP peak it finds into `candidates`. +// The diagonal starts at (start_row, start_col) and runs for `max_len` cells. +#[inline] +fn process_diagonal_into_candidates( + params: &UngappedAlignmentParams, + candidates: &mut BinaryHeap, + start_row: usize, + start_col: usize, + max_len: usize, +) { + let mut curr_score: i32 = 0; + let mut segment_start_idx: usize = 0; // index along diagonal where current positive segment started + let mut peak_score: i32 = 0; + let mut peak_idx: usize = 0; // index along diagonal where peak occurred + + for i in 0..max_len { + let row = start_row + i; + let col = start_col + i; + let val = params.match_score(row, col); + + if curr_score == 0 && val <= 0 { + continue; } - }; - - let mut process_diagonal = |start_row: usize, start_col: usize, max_len: usize| { - let mut curr_score = 0; - let mut segment_start_idx = 0; // index along diagonal where current positive segment started - let mut peak_score = 0; - let mut peak_idx = 0; // index along diagonal where peak occurred - - for i in 0..max_len { - let row = start_row + i; - let col = start_col + i; - let val = params.match_score(row, col); - - if curr_score == 0 && val <= 0 { - continue; - } - if curr_score == 0 { - segment_start_idx = i; - } - - curr_score += val; - - if curr_score <= 0 { - add_candidate( - peak_score, - start_col + segment_start_idx, - start_row + segment_start_idx, - peak_idx - segment_start_idx + 1, - ); - curr_score = 0; - peak_score = 0; - } else { - if curr_score > peak_score { - peak_score = curr_score; - peak_idx = i; - } - } + if curr_score == 0 { + segment_start_idx = i; } - add_candidate( - peak_score, - start_col + segment_start_idx, - start_row + segment_start_idx, - peak_idx - segment_start_idx + 1, - ); - }; - - // Diagonals starting at first row (row=0, col=0..sa_len) - for start_col in 0..sa_len { - let max_len = std::cmp::min(sa_len - start_col, sb_len); - process_diagonal(0, start_col, max_len); - } - // Diagonals starting at first column (row=1..sb_len, col=0) - for start_row in 1..sb_len { - let max_len = std::cmp::min(sa_len, sb_len - start_row); - process_diagonal(start_row, 0, max_len); + curr_score += val; + + if curr_score <= 0 { + push_candidate( + candidates, + peak_score, + start_col + segment_start_idx, + start_row + segment_start_idx, + peak_idx - segment_start_idx + 1, + ); + curr_score = 0; + peak_score = 0; + } else if curr_score > peak_score { + peak_score = curr_score; + peak_idx = i; + } } + push_candidate( + candidates, + peak_score, + start_col + segment_start_idx, + start_row + segment_start_idx, + peak_idx - segment_start_idx + 1, + ); +} - // Select top k non-overlapping +// Pop top-k highest-scoring candidates from the heap, dropping any that overlap +// an already-accepted candidate on the A and/or B axis. Returns Alignments in +// score-descending order. +fn select_top_k_with_overlap_filter( + params: &UngappedAlignmentParams, + mut candidates: BinaryHeap, + k: usize, + filter_overlap_a: bool, + filter_overlap_b: bool, +) -> Vec { let mut alignments: Vec = Vec::with_capacity(k); while alignments.len() < k { @@ -1134,7 +1137,7 @@ fn _top_k_ungapped_local_align_core( len: candidate.len as i32, }], score: candidate.score, - stats: stats, + stats, }); } } else { @@ -1142,7 +1145,136 @@ fn _top_k_ungapped_local_align_core( } } - Ok(alignments) + alignments +} + +fn _top_k_ungapped_local_align_core( + params: UngappedAlignmentParams, + k: usize, + filter_overlap_a: bool, + filter_overlap_b: bool, +) -> PyResult> { + let sa_len = params.sa.len(); + let sb_len = params.sb.len(); + + let mut candidates: BinaryHeap = BinaryHeap::new(); + + // Diagonals starting at first row (row=0, col=0..sa_len) + for start_col in 0..sa_len { + let max_len = std::cmp::min(sa_len - start_col, sb_len); + process_diagonal_into_candidates(¶ms, &mut candidates, 0, start_col, max_len); + } + + // Diagonals starting at first column (row=1..sb_len, col=0) + for start_row in 1..sb_len { + let max_len = std::cmp::min(sa_len, sb_len - start_row); + process_diagonal_into_candidates(¶ms, &mut candidates, start_row, 0, max_len); + } + + Ok(select_top_k_with_overlap_filter( + ¶ms, + candidates, + k, + filter_overlap_a, + filter_overlap_b, + )) +} + +// K-mer-seeded variant of `_top_k_ungapped_local_align_core`. Builds an exact- +// match k-mer index of `seqa`, finds every k-mer hit between `seqa` and `seqb`, +// and runs the diagonal positive-segment scan only on diagonals that contain +// at least one such hit. Skips diagonals where no k-mer of length `kmer_size` +// matches between the two sequences, which is the source of the speedup over +// the all-diagonals scan. +// +// Correctness: an HSP on a diagonal is found iff at least one window of +// `kmer_size` consecutive exact-match bytes lies on that diagonal between the +// two sequences. HSPs whose match runs are all strictly shorter than +// `kmer_size` are missed. For text alphabets and `kmer_size <= 5`, this only +// occurs at very small HSP scores. +fn _top_k_ungapped_local_align_kmer_core( + params: UngappedAlignmentParams, + k: usize, + kmer_size: usize, + max_hits_per_kmer: usize, + filter_overlap_a: bool, + filter_overlap_b: bool, +) -> PyResult> { + if kmer_size == 0 || kmer_size > 8 { + return Err(PyErr::new::( + "kmer_size must be in [1, 8]", + )); + } + + let sa_len = params.sa.len(); + let sb_len = params.sb.len(); + + if sa_len < kmer_size || sb_len < kmer_size { + return Ok(Vec::new()); + } + + // Pack a k-mer of size <= 8 into a u64. The mask isolates the active bytes. + let kmer_mask: u64 = if kmer_size == 8 { + u64::MAX + } else { + (1u64 << (8 * kmer_size)) - 1 + }; + + // K-mer index of seqa: rolling-hashed k-mer -> positions in sa. + let mut kmer_index: HashMap> = HashMap::new(); + { + let mut rolling: u64 = 0; + for (i, &byte) in params.sa.iter().enumerate() { + rolling = ((rolling << 8) | (byte as u64)) & kmer_mask; + if i + 1 >= kmer_size { + let pos = (i + 1 - kmer_size) as u32; + kmer_index.entry(rolling).or_default().push(pos); + } + } + } + + // Collect the set of diagonals that have at least one k-mer hit. + // diag = sa_pos - sb_pos, range [-(sb_len-1), sa_len-1]. + let mut hit_diagonals: HashSet = HashSet::new(); + { + let mut rolling: u64 = 0; + for (i, &byte) in params.sb.iter().enumerate() { + rolling = ((rolling << 8) | (byte as u64)) & kmer_mask; + if i + 1 >= kmer_size { + let sb_pos = (i + 1 - kmer_size) as i64; + if let Some(positions) = kmer_index.get(&rolling) { + // Cap on hits-per-kmer protects against quadratic blowup + // on low-complexity stretches (e.g. long runs of spaces). + if positions.len() > max_hits_per_kmer { + continue; + } + for &sa_pos in positions { + let diag = (sa_pos as i64) - sb_pos; + hit_diagonals.insert(diag); + } + } + } + } + } + + let mut candidates: BinaryHeap = BinaryHeap::new(); + for &diag in &hit_diagonals { + let (start_row, start_col) = if diag >= 0 { + (0usize, diag as usize) + } else { + ((-diag) as usize, 0usize) + }; + let max_len = std::cmp::min(sa_len - start_col, sb_len - start_row); + process_diagonal_into_candidates(¶ms, &mut candidates, start_row, start_col, max_len); + } + + Ok(select_top_k_with_overlap_filter( + ¶ms, + candidates, + k, + filter_overlap_a, + filter_overlap_b, + )) } /// Finds the top-k non-overlapping ungapped local alignments (HSPs). @@ -1236,6 +1368,62 @@ fn top_k_ungapped_local_align_many<'py>( }) } +/// Finds the top-k non-overlapping ungapped local alignments (HSPs) using k-mer seeding. +/// +/// Functionally similar to `top_k_ungapped_local_align` but much faster on long inputs +/// over moderate-sized alphabets: HSPs are sought only on diagonals of the n*m grid that +/// contain at least one exact k-mer match between `seqa` and `seqb`, instead of scanning +/// every diagonal. +/// +/// Correctness: an HSP is found iff at least one window of `kmer_size` consecutive +/// exact-match bytes lies on its diagonal between the two sequences. HSPs whose match +/// runs are all strictly shorter than `kmer_size` are missed. For text alphabets and +/// `kmer_size <= 5`, this only occurs at very small HSP scores. +/// +/// Args: +/// seqa (bytes): The first sequence. +/// seqb (bytes): The second sequence. +/// score_matrix (numpy.ndarray): Scoring matrix. +/// k (int): Maximum number of alignments to return. +/// kmer_size (int): Seed length in bytes; must be in [1, 8]. +/// max_hits_per_kmer (int): Skip k-mers that appear more than this many times in +/// `seqa`; protects against quadratic blowup on low-complexity stretches +/// (long runs of spaces, common short fragments, etc.). +/// filter_overlap_a (bool): Drop later HSPs that overlap an accepted HSP on A. +/// filter_overlap_b (bool): Drop later HSPs that overlap an accepted HSP on B. +/// +/// Returns: +/// list[Alignment]: Up to `k` non-overlapping alignments, in descending score order. +#[gen_stub_pyfunction] +#[pyfunction] +#[pyo3(signature = (seqa, seqb, score_matrix, k, kmer_size, max_hits_per_kmer, filter_overlap_a=true, filter_overlap_b=true))] +fn top_k_ungapped_local_align_kmer<'py>( + py: Python<'py>, + seqa: &Bound<'py, PyBytes>, + seqb: &Bound<'py, PyBytes>, + score_matrix: PyReadonlyArray2, + k: usize, + kmer_size: usize, + max_hits_per_kmer: usize, + filter_overlap_a: bool, + filter_overlap_b: bool, +) -> PyResult> { + let seqa = seqa.as_bytes().to_vec(); + let seqb = seqb.as_bytes().to_vec(); + let score_matrix = score_matrix.as_array().into_owned(); + + py.detach(move || { + _top_k_ungapped_local_align_kmer_core( + UngappedAlignmentParams::new(&seqa, &seqb, &score_matrix)?, + k, + kmer_size, + max_hits_per_kmer, + filter_overlap_a, + filter_overlap_b, + ) + }) +} + #[pymodule] fn _seq_smith(_py: Python, m: &Bound<'_, PyModule>) -> PyResult<()> { m.add_wrapped(wrap_pyfunction!(local_align))?; @@ -1248,6 +1436,7 @@ fn _seq_smith(_py: Python, m: &Bound<'_, PyModule>) -> PyResult<()> { m.add_wrapped(wrap_pyfunction!(overlap_align_many))?; m.add_wrapped(wrap_pyfunction!(top_k_ungapped_local_align))?; m.add_wrapped(wrap_pyfunction!(top_k_ungapped_local_align_many))?; + m.add_wrapped(wrap_pyfunction!(top_k_ungapped_local_align_kmer))?; m.add_class::()?; m.add_class::()?; m.add_class::()?; diff --git a/tests/test_seq_smith.py b/tests/test_seq_smith.py index 4911f2e..d3e6e29 100644 --- a/tests/test_seq_smith.py +++ b/tests/test_seq_smith.py @@ -14,6 +14,7 @@ make_score_matrix, overlap_align, top_k_ungapped_local_align, + top_k_ungapped_local_align_kmer, top_k_ungapped_local_align_many, ) @@ -589,3 +590,142 @@ def test_top_k_ungapped_many_simple() -> None: # So should be empty if score <= 0. # Our implementation returns empty if no positive peaks. assert len(alignments_list[1]) == 0 + + +# ------------------------------------------------------------------------- +# top_k_ungapped_local_align_kmer +# ------------------------------------------------------------------------- + + +def test_top_k_ungapped_kmer_simple() -> None: + """K-mer seeding finds the same two HSPs as the all-diagonals scan.""" + alphabet = "ACGT" + seqa = encode("AAAATTTTCCCC", alphabet) + seqb = encode("AAAAGGGGCCCC", alphabet) + score_matrix = make_score_matrix(alphabet, match_score=2, mismatch_score=-5) + + alignments = top_k_ungapped_local_align_kmer( + seqa, seqb, score_matrix, k=5, kmer_size=3, max_hits_per_kmer=100, + ) + + assert len(alignments) == 2 + assert alignments[0].score == 8 + assert alignments[1].score == 8 + starts = sorted([(a.fragments[0].sa_start, a.fragments[0].sb_start) for a in alignments]) + assert starts == [(0, 0), (8, 8)] + + +def test_top_k_ungapped_kmer_matches_full_scan_random_dna() -> None: + """The k-mer seeder must agree with the all-diagonals scan on any input + where HSP score >= 8 (well above the floor where seed misses can occur).""" + rng = np.random.default_rng(42) + alphabet = "ACGT" + seqa = bytes(rng.integers(0, 4, size=400, dtype=np.uint8)) + seqb = bytes(rng.integers(0, 4, size=350, dtype=np.uint8)) + score_matrix = make_score_matrix(alphabet, match_score=1, mismatch_score=-1) + + full = top_k_ungapped_local_align(seqa, seqb, score_matrix, k=20) + kmer = top_k_ungapped_local_align_kmer( + seqa, seqb, score_matrix, k=20, kmer_size=3, max_hits_per_kmer=10_000, + ) + + # On a tiny 4-letter alphabet at k=3 the seeder is dense enough that we + # expect every HSP scoring >= 5 to be caught. Compare the top-scoring + # HSPs above that floor. + def key(a) -> tuple[int, int, int]: + return (-a.score, a.fragments[0].sa_start, a.fragments[0].sb_start) + + full_top = sorted([a for a in full if a.score >= 5], key=key) + kmer_top = sorted([a for a in kmer if a.score >= 5], key=key) + assert [(a.score, a.fragments[0].sa_start, a.fragments[0].sb_start, a.fragments[0].len) for a in full_top] == [ + (a.score, a.fragments[0].sa_start, a.fragments[0].sb_start, a.fragments[0].len) for a in kmer_top + ] + + +def test_top_k_ungapped_kmer_overlap() -> None: + """Overlap filtering on B works the same as in the all-diagonals scan.""" + alphabet = "ACGT" + seqa = encode("AAAATTTTCCCCAAAATTTTCCCCAAAATTTTCCCC", alphabet) + seqb = encode("AAAAGGGGCCCC", alphabet) + score_matrix = make_score_matrix(alphabet, match_score=2, mismatch_score=-5) + + alignments = top_k_ungapped_local_align_kmer( + seqa, seqb, score_matrix, k=5, + kmer_size=3, max_hits_per_kmer=100, filter_overlap_b=False, + ) + + assert len(alignments) == 5 + assert all(a.score == 8 for a in alignments) + starts = sorted([(a.fragments[0].sa_start, a.fragments[0].sb_start) for a in alignments]) + for c, r in starts: + assert seqa[c : c + 4] == seqb[r : r + 4] + + +def test_top_k_ungapped_kmer_limit() -> None: + """Top-k truncation works the same as in the all-diagonals scan.""" + alphabet = "ACGT" + seqa = encode("AATTCCTTGG", alphabet) + seqb = encode("AAGGCCGGGG", alphabet) + score_matrix = make_score_matrix(alphabet, match_score=2, mismatch_score=-5) + + alignments = top_k_ungapped_local_align_kmer( + seqa, seqb, score_matrix, k=2, kmer_size=2, max_hits_per_kmer=100, + ) + + assert len(alignments) == 2 + assert alignments[0].score == 4 + assert alignments[1].score == 4 + + +def test_top_k_ungapped_kmer_invalid_kmer_size() -> None: + """kmer_size must be in [1, 8]; outside that range raises ValueError.""" + alphabet = "ACGT" + seqa = encode("ACGT", alphabet) + seqb = encode("ACGT", alphabet) + score_matrix = make_score_matrix(alphabet, 1, -1) + + with pytest.raises(ValueError, match="kmer_size"): + top_k_ungapped_local_align_kmer( + seqa, seqb, score_matrix, k=1, kmer_size=0, max_hits_per_kmer=10, + ) + with pytest.raises(ValueError, match="kmer_size"): + top_k_ungapped_local_align_kmer( + seqa, seqb, score_matrix, k=1, kmer_size=9, max_hits_per_kmer=10, + ) + + +def test_top_k_ungapped_kmer_seqs_shorter_than_kmer() -> None: + """Sequences shorter than `kmer_size` produce no HSPs (no k-mer index).""" + alphabet = "ACGT" + seqa = encode("AC", alphabet) + seqb = encode("AC", alphabet) + score_matrix = make_score_matrix(alphabet, 1, -1) + + alignments = top_k_ungapped_local_align_kmer( + seqa, seqb, score_matrix, k=5, kmer_size=4, max_hits_per_kmer=10, + ) + assert alignments == [] + + +def test_top_k_ungapped_kmer_max_hits_skips_low_complexity() -> None: + """A k-mer occurring more than `max_hits_per_kmer` times in seqa is skipped. + + With ``max_hits_per_kmer=0`` no k-mer hit is ever followed up, so even an + identity pair returns no HSPs. This is the knob that protects against + quadratic blowup on long runs of the same character. + """ + alphabet = "ACGT" + seqa = encode("AAAAAAAAAA", alphabet) + seqb = encode("AAAAAAAAAA", alphabet) + score_matrix = make_score_matrix(alphabet, 1, -1) + + full_alignments = top_k_ungapped_local_align_kmer( + seqa, seqb, score_matrix, k=5, kmer_size=3, max_hits_per_kmer=100, + ) + assert len(full_alignments) >= 1 + assert full_alignments[0].score == 10 + + capped_alignments = top_k_ungapped_local_align_kmer( + seqa, seqb, score_matrix, k=5, kmer_size=3, max_hits_per_kmer=0, + ) + assert capped_alignments == []