NucleoByte: GPU-Accelerated Block-Sparse Genomic Language Model

NucleoByte is a high-performance, custom-engineered Transformer architecture built from scratch for genomic sequence modeling. It bypasses standard deep learning overhead by routing zero-copy, VRAM-resident tensor operations directly from PyTorch into native C++/CUDA hardware kernels.

---

1. The Core Problem

Standard Natural Language Processing (NLP) models face major scaling bottlenecks when applied to genomics:

• The Context Trap: DNA sequences are continuous, massive strings (often millions of base pairs) rather than brief, punctuated sentences. Standard dense $O(N^2)$ attention scaling becomes mathematically and financially prohibitive at scale.
• Padding Waste: Typical tokenizers or data collators force variable-length sequences to conform to fixed global lengths, allocating massive amounts of VRAM to zero-padding tokens that compute useless context, waste hardware cycles, and corrupt embedding tables with gradient noise.
• Token Blur: Biological representations (like $K$-mers) require massive vocabularies if computed dynamically via standard BPE. A hard-coded, bit-packed sliding window approach is required for native DNA parsing.

---

2. The Architectural Goal

NucleoByte optimizes genomic sequence training through a highly specialized pipeline:

1. Fused 2-Bit Tokenization: Native GPU string parsing that packs DNA bases into memory-efficient integer IDs on the fly.
2. Dynamic Ceiling Hardware Alignment: A custom data pipeline that dynamically pads batches up to the nearest multiple of the hardware block size ($32$), completely wiping out artificial padding overhead.
3. Local Hybrid Block-Sparse Attention: Restricting the model's receptive field to a tightly bounded local sliding neighborhood ($W$) to drop attention time and memory complexity from quadratic $O(N^2)$ to linear $O(N \cdot W)$.

---

3. Mathematical Foundations

Localized Block-Sparse Attention Matrix

Instead of calculating the dense dot-product between all Queries ($Q$) and Keys ($K$) across the full sequence $N$, attention computation is structurally constrained using a window block radius $R$. For a block size $B = 32$, a token block index $i$ only computes attention scores against key block indices $j$ that satisfy:

$$|i - j| \le R$$

Dense Attention O(N²)           NucleoByte Block-Sparse O(N * W)
   [X X X X X X X X]                   [B B B . . . . .]  <- Block-Row i=0
   [X X X X X X X X]                   [B B B B . . . .]
   [X X X X X X X X]                   [B B B B B . . .]
   [X X X X X X X X]       ====>       [. B B B B B . .]  Window Radius (R) = 1
   [X X X X X X X X]                   [. . B B B B B .]  Block Size (B) = 32
   [X X X X X X X X]                   [. . . B B B B B]
   [X X X X X X X X]                   [. . . . B B B B]
   [X X X X X X X X]                   [. . . . . B B B]

Softmax Normalization & Online Numerical Stability

To maintain absolute stability without standard PyTorch tracking arrays, the forward kernel handles FlashAttention-inspired online softmax scaling. For row block $i$ and column block $j$, the raw attention weights $S_{ij}$ are scaled by the dimension factor:

$$S_{ij} = \frac{Q_i K_j^T}{\sqrt{d_k}}$$

To prevent floating-point explosion during exponentiation ($\text{expf}$), the running maximum $m_i$, log-sum-exp tracking scale $d_i$, and running output aggregation $O_i$ are accumulated dynamically across active block boundaries:

$$m_i^{\text{new}} = \max(m_i^{\text{old}}, \max(S_{ij}))$$

$$d_i^{\text{new}} = d_i^{\text{old}} \cdot e^{(m_i^{\text{old}} - m_i^{\text{new}})} + \sum e^{(S_{ij} - m_i^{\text{new}})}$$

$$O_i^{\text{new}} = O_i^{\text{old}} \cdot e^{(m_i^{\text{old}} - m_i^{\text{new}})} + \sum e^{(S_{ij} - m_i^{\text{new}})} \cdot V_j$$

Custom Backpropagation

Gradients are calculated inside a manual backpropagation CUDA kernel using atomicAdd routines to handle accumulation over shared key-value blocks. Softmax differentiation incorporates a pre-calculated row correction term $D_i$ mapped globally across dimensions:

$$ D_i = \sum_k \left( (\nabla O)_{ik} \cdot O_{ik} \right) $$

$$ (\nabla S)_{ij} = P_{ij} \cdot \left( (\nabla O)_i V_j^T - D_i \right) $$

---

4. Tech Stack

• Frontend Framework: PyTorch (custom torch.autograd.Function integration).
• Acceleration Language: Native C++17 / CUDA C (Shared Memory tiling, Warp Shuffle primitives, Warp-level reduction).
• Interoperability Bridge: pybind11 (facilitating raw GPU device memory pointer exchange via uintptr_t casting).

---

5. Temporary Status & Milestone Validation

Project Status: Active Development & Optimization Mode.

The core math engine, forward/backward loops, and hardware interfaces have been fully validated. To prove generalization capabilities under dynamic conditions, a validation run was executed using a shifting-window data load:

• Corpus Source: gencode.v49.transcripts.fa (Human genomic transcript mapping)
• Dataset Scale: 533,740 continuous chromosomal blocks / 266,870 batches per epoch
• Architecture Size: 3 Layers, 2 Heads, Embedding Dim 128, $K$-mer Size 6 ($4096$ Vocab + Padding/Mask)
• Milestone Outcome: Initialized at a random guess loss boundary of 8.32. Aborted early at Step 30,355 with training loss successfully reduced to 0.9340.

Evaluation Output Verification

During subsequent Masked Language Modeling (MLM) extraction tests, the model accurately resolved structural context within local boundaries to pinpoint masked target segments:

Original Input DNA Sequence : CCCAGGGTCCGATGGGAAAGTGTAGCCTGC
Masked Token Index Position : 12
Target Ground-Truth 6-mer   : 'TGGGAC' (ID: 3745)

=========================================================
               NUCLEOBYTE INFERENCE PREDICTIONS
=========================================================
Rank 1 | Prediction: 'TGGGAC' (ID: 3745) | Confidence: 10.16% (GROUND TRUTH MATCH!)
Rank 2 | Prediction: 'TGAAGT' (ID: 3595) | Confidence: 5.40%
Rank 3 | Prediction: 'GGCCCC' (ID: 2645) | Confidence: 3.12%

---

6. Project Directory Setup & Basic Usage

Compilation

The engine requires an environment with standard PyTorch installation alongside the NVIDIA CUDA Toolkit (including nvcc). Build the PyBind core using standard C++ build automation:

mkdir out && cd out
cmake .. -DCMAKE_BUILD_TYPE=Release
cmake --build . --config Release

Script Execution

The underlying layers handle standard PyTorch instantiation pipelines seamlessly:

import torch
from nucleobyte.model import NucleoByteLM

# Initialize the validated hardware configuration 
model = NucleoByteLM(
    vocab_size=4100, 
    embed_dim=128, 
    num_heads=2, 
    num_layers=3, 
    window_radius=1, 
    block_size=32
).cuda()

# Synthetic token batch representing aligned sequence tokens
input_ids = torch.randint(1, 4096, (2, 4096), dtype=torch.long).cuda()

# Forward execution maps down directly into the block-sparse CUDA kernel
logits = model(input_ids)
print("Logits Shape:", logits.shape) # Expected: [2, 4096, 4100]