Skip to content

Repository files navigation

RIMA

Rational Indel Meta-Analysis (RIMA)

Updated version 2024

Please visit the updated repository here https://github.com/Ghahfarokhi/ATG_CRISPRess2_to_RIMA2

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Old version instruction

Introduction

Double strand breaks (DSBs) in mammalian cells are the most deleterious DNA lesions that if remained unrepaired can cause cell death or genome instability. A variety of programmable nucleases can be used in the context of genome-editing to induce DSBs into the human genome in a targeted manner. These nucleases include Zinc Finger Nuclease (ZFNs), Transcription Activator Like Effector Nucleases (TALENs) and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9 system. The latter becomes the most versatile system applicable for genome-editing in many organisms including bacteria, plants, animals and human cells. Repair of a Cas9-induced cut in human cells results in introduction of non-random mutations at the targeted site. Variation among the mutational signatures at different target sites can be due to many reasons. However, studying the mutational signatures and their variations could results a better understanding of the repair pathways, kinetics of the cleavage and possible interactions between the DNA lesions (as substrate) and the DNA repair pathways. Rational Indel Meta-Analysis (RIMA) is a tool that has been developed in the course of our study and would allow biologists to analyse their data without prior Bioinformatics knowledge. A general workflow for studying the mutation signatures is provided below (Figure 1):

Output screenshot

Visualizing Cas9 induced mutation patterns.

Deep sequencing of CRISPR targeted loci provides a robust assay to quantify the Cas9 cutting efficiency and study the induced mutation patterns. This code visualizes a variant table resulted from mutations detected in deep sequencing data.

Inputs:
  1. Table of variant in .xlsx format or as the following template.
Reference Position Type Length Reference Allele Count MicroHomology Duplication Rel. Freq.
133 Insertion 1 - T 6594 Detected 35.48213517
121 Deletion 12 TGGAAGCACGAA - 1227 3 6.602453724
130 Deletion 9 GAATGGTTG - 854 3 4.595350839
121 Deletion 16 TGGAAGCACGAATGGT - 820 5 4.412397762
133 Deletion 1 T - 689 3.707490314
134 Deletion 1 G - 687 3.696728368
132 Deletion 2 AT - 624 0 3.357727077
130 Deletion 4 GAAT - 515 0 2.771201033
134 Insertion 2 - AT 498 Detected 2.679724494
133 Deletion 4 TGGT - 421 3 2.265389582
118 Deletion 16 GCCTGGAAGCACGAAT - 375 0 2.01786483
  1. Sequence of the RefSeq, which has been used to map the reads.

refseq="TGCCTGCATTTTAGTCGTGAGATGGAGAATAAAGAAACTCTCAAAGGGTTGCACAAGATGGATGATCGTCCAGAGGAACGAATGATCAGGGAGAAACTGAAGGCAACCTGTATGCCAGCCTGGAAGCACGAATGGTTGGAAAGGAGAAATAGGCGAGGGCCTGTGGTAAGTGGCTATGGG"

  1. Sequence of the sgRNA, without PAM.

sgrna="AGCCTGGAAGCACGAATGGT"

Output:

Output screenshot

Author:

Amir Taheri-Ghahfarokhi

Email: Amir.Taheri-Ghahfarokhi@astrazeneca.com Email: Amir.Taheri.Ghahfarokhi@gmail.com

Link to Linkedin!

How to cite RIMA:

Taheri-Ghahfarokhi A., et al. (2018) Decoding non-random mutational signatures at Cas9 targeted sites. Nucleic Acids Research. doi: 10.1093/nar/gky653

About

Rational Indel Meta-Analysis (RIMA); An Excel-based tool for mutational pattern analysis.

Topics

Resources

Stars

0 stars

Watchers

1 watching

Forks

Releases

Packages

Contributors