Variant in, corrective edit out.
A variant-driven, multi-modality, uncertainty-aware CRISPR guide & edit design framework — across SpCas9 nuclease, base editors, and prime editors, with population-aware off-target nomination and a public benchmark.
Warning
AlleleForge is a research tool. It is not a medical device and does not provide medical advice. It produces ranked, explicitly uncertain design hypotheses. Every off-target nomination it makes is computational and must be experimentally validated before any wet-lab or therapeutic use. See Scope & responsible use.
Most monogenic disease is, in effect, a copy-paste error at the allele level. The job of a genome editor is to forge the corrective edit. Today that job is fragmented across a dozen single-purpose tools — one to pick a guide, another to predict efficiency, a third to enumerate prime-editing extensions, a fourth to scan for off-targets — none of which speak the same language and few of which agree on what "uncertain" means.
AlleleForge unifies the journey behind one typed interface: you supply a variant, it returns a ranked, safety-annotated menu of candidate edits spanning every applicable modality, each carrying a calibrated uncertainty interval, a predicted edit outcome, and a population- and haplotype-aware off-target report.
For prime editing in particular, no existing open-source tool combines all four of:
| Axis | PRIDICT2.0 | PrimeDesign / PrimeVar | CRISPRme | AlleleForge |
|---|---|---|---|---|
| Therapeutic variant front-end | ✗ | ✓ | ✗ | ✓ |
| ML efficiency with calibrated uncertainty | ✓ | ✗ | ✗ | ✓ |
| Outcome / byproduct prediction | partial | ✗ | ✗ | ✓ |
| Population-aware off-target | ✗ | ✗ | ✓ | ✓ |
AlleleForge's contribution is to wrap the best existing models (PRIDICT2.0, BE-Hive, BE-DICT, inDelphi, Cas-OFFinder, …) behind a unified, typed, uncertainty-honest interface and add value at the seams.
- Variant-first. The canonical journey starts from what is broken, not from a guide.
- Honest uncertainty. Every numeric prediction ships with a calibrated interval. No scorer returns a bare float.
- Population-aware by default. Reference-only off-target analysis is a known safety gap (the Casgevy /
BCL11A
rs114518452case is the canonical cautionary tale). AlleleForge searches population variation by default. - Wrap, don't rebuild. Integrate proven tools; add new ML only at genuine coverage gaps.
- Reproducible to the byte. Pinned environments, versioned datasets, deterministic seeds, content-hashed checkpoints.
- Three audiences, one core. The library is the source of truth; CLI and web are thin shells over it.
- Typed and tested.
mypy --strict,ruff, and Hypothesis property tests on all core logic. - Cite everything. Every dataset, model, and scoring function carries a literature citation and a version.
The principles above are realized by a handful of concrete, non-obvious engineering tradeoffs. Each was chosen to maximize reproducibility, honest uncertainty, and population-aware safety — in that order; the rationale and the code that enforces it:
| Decision | Why — and where it lives |
|---|---|
Weight-free stubs are the CI default; real weights are opt-in (real_weights marker) |
The full gate (lint, type, test, docs, examples, reproduce) runs with no GPU, network, or torch, so any contributor reproduces it byte-for-byte. The consent/license/checksum flow is still exercised in CI with an injected downloader; only the tensor load / forward pass is gated. See SPEC_V2.md R1. |
| An unverifiable artifact is refused, never fetched | A null checkpoint/dataset hash blocks the download by design — you cannot silently load an unpinned weight or dataset. The pin is a content hash, never a mutable tag. (model_zoo/loader.py, R0/R1.) |
FM-index auto-engages per region past 1 Mb (FM_INDEX_AUTO_THRESHOLD) |
Building the index has a fixed cost that only amortizes at contig scale; below the threshold the linear PAM pass wins. The result is byte-identical either way (parity-pinned). (offtarget/engine.py.) |
The k-mer seed prefilter engages only when k ≥ 5 (MIN_SELECTIVE_K) |
Honest micro-benchmark finding: a 4-letter alphabet saturates short k-mers, so a short seed prunes almost nothing and only adds overhead. k ≥ 5 (low edit budget) measures ~2–4×; at the default ≤4-mismatch+bulge budget the seed is too short, so the FM-index stays the genome-scale path. (offtarget/_search.py, R2.) |
| Every native kernel keeps a parity-tested pure-Python fallback; the library never requires the crate | prefer_native selects Rust when built; CI runs the off-target engine on both paths. Trades raw speed-when-unbuilt for "installs and passes anywhere; native is a pure bonus." (SPEC_V2.md R2.) |
| Off-target nomination is an OR of two thresholds (CFD ≥ 0.20 or MIT ≥ 0.10), and both scores are recorded per site | Two complementary specificity models catch different failure shapes; recording both (OffTargetSite.mit_score) keeps a MIT-nominated, low-CFD site auditable rather than mysteriously retained. (offtarget/scoring.py.) |
| Ancestry risk is the worst-affected population, never the average; "carrying" means at/above the MAF threshold | Averaging hides risk concentrated in one ancestry — the BCL11A cautionary tale. The carrying threshold is applied identically on the population and haplotype paths, so a trace, sub-threshold frequency cannot inflate the per-ancestry burden. (types/offtarget.py.) |
| The cross-run off-target cache is safety-gated to reference-only, default-scorer searches | A wrong off-target report is a missed danger, so a possibly-stale entry is never served once population / haplotype / patient augmentation is present (the key cannot fully capture that external data). (offtarget/cache.py, R4.) |
| Intervals are recalibrated by split-conformal; probabilities by isotonic regression | Different calibration targets need different tools — a finite-sample coverage guarantee for regression intervals, monotone probability calibration for classification — with empirical_coverage / ECE flagging when each is needed. (scoring/uncertainty.py, R5.) |
| The default backbone is non-commercial, and the license gate enforces it | Nucleotide Transformer v2 (500M) is CC-BY-NC-SA-4.0 — loadable for research, refused for commercial use at load time. Real weights are never vendored. (model_zoo/cards/, R1.) |
| Results, splits, and caches are content-addressed | A published benchmark number cannot be silently edited (each result carries a signature); a split pins both its dataset-content hash and its own membership hash, re-verified on read (SplitIntegrityError on drift). (benchmark/.) |
A ReferenceGenome is thread-safe to share; cohort workers still get their own |
pyfaidx has a shared file position, so concurrent reads on one handle race. The web server's sync handlers run in a threadpool over one shared reference, so each read is guarded by a per-instance lock (covering the read, not the CPU-bound design that follows). The cohort path instead hands each worker its own handle via a reference_factory — safe and parallel I/O. (genome/reference.py.) |
AlleleForge is strictly layered: lower layers know nothing about higher ones. The Designer is the only component that sees the whole pipeline; every domain service is independently testable and usable.
flowchart TB
subgraph I["Interfaces"]
PY["Python library"]
CLI["aforge CLI"]
WEB["Web UI (FastAPI + Next.js)"]
end
subgraph O["Orchestration"]
DES["Designer: variant → routing → candidates → score → outcome → off-target → rank → report"]
end
subgraph D["Domain services"]
VR["Variant resolver<br/>(HGVS, ClinVar)"]
EN["Guide enumerators<br/>(cas9, base, prime)"]
SC["Scoring<br/>(efficiency, outcome, uncertainty)"]
OT["Off-target engine<br/>(population / haplotype)"]
end
subgraph F["Foundations"]
GA["Genome access<br/>(FASTA, FM-index)"]
DR["Data registry<br/>(DVC, gnomAD, ClinVar)"]
MZ["Model zoo<br/>(ckpt hashing)"]
CT["Core types and schemas"]
end
RUST["Rust / PyO3 — aforge_native: BWT off-target search · k-mer hashing · haplotype walking"]
I --> O --> D --> F
OT -.calls.-> RUST
EN -.calls.-> RUST
sequenceDiagram
autonumber
actor U as User
participant R as Resolver
participant Rt as Router
participant E as Enumerators
participant S as Scorers
participant X as Off-target engine
participant K as Ranker
U->>R: ClinVar / rsID / HGVS / VCF / coords
R->>Rt: normalized Variant and consequence
Rt->>E: eligible chemistries (nuclease / base / prime)
E->>S: candidate guides and pegRNAs
Note over S: efficiency and outcome (calibrated Prediction)
E->>X: spacers and nicks
Note over X: reference, then population, then haplotype, then patient VCF
S->>K: scored candidates
X->>K: ancestry-stratified off-target reports
K-->>U: RankedMenu (Pareto front, provenance, disclaimer)
AlleleForge is built in ordered phases (see SPEC.md, the authoritative build contract). Phases
0–5 establish the spine before any modality or ML code.
| Phase | Component | Status |
|---|---|---|
| 0 | Repo bootstrap, CI, packaging, Rust toolchain | ✅ done |
| 1 | Core domain types & schemas (types/) |
✅ done |
| 2 | Genome access & indexing (genome/) |
✅ done |
| 3 | Data registry & population datasets (data/) |
✅ done |
| 4 | Variant resolver (variant/) |
✅ done |
| 5 | Off-target engine — population & haplotype aware (offtarget/) |
✅ done |
| 6 | Scoring foundations: model zoo, embeddings, uncertainty (scoring/, model_zoo/) |
✅ done |
| 7 | Chemistry: SpCas9 nuclease (enumerate/, scoring/, design/) |
✅ done |
| 8 | Chemistry: base editing — ABE / CBE (enumerate/, scoring/, design/) |
✅ done |
| 9 | Chemistry: prime editing — the flagship (enumerate/, scoring/, design/) |
✅ done |
| 10 | Designer: routing, candidate menu, ranking (design/) |
✅ done |
| 11 | Reporting & oligo output (report/) |
✅ done |
| 12 | CLI (aforge) (cli/) |
✅ done |
| 13 | Web UI & API (web/) |
✅ done |
| 14 | CRISPR-Bench: tasks, frozen splits, metrics, runner, leaderboard (benchmark/) |
✅ done |
| 15 | Docs, runnable examples, release engineering (docs/, examples/) |
✅ done |
All fifteen v0.1.0 phases are complete. Post-v0.1.0 work to "bake" the release toward v1.0 is tracked
in SPEC_V2.md:
| Track | Scope | Status |
|---|---|---|
| R0 | Release hardening: pin real artifact hashes; supply-chain; reproducibility audit | ◐ in progress |
| R1 | Real-weights model integration through the consent-gated model zoo | ◐ in progress |
| R2 | Native bwt/kmer/haplotype kernels wired onto the off-target hot paths |
◐ in progress |
| R3 | External-tool adapters (Cas-OFFinder, VEP, HGVS) behind the registry | ◐ in progress |
| R4 | Scale: whole-genome on-disk FM-index (SA-IS), cohort throughput, cross-run caches | ◐ in progress |
| R5 | Validation, calibration study (ECE on real data), methods preprint | ◐ in progress |
| R6 | v1.0 release criteria | ☐ not started |
Landed since v0.1.0. R0 — Dependabot across pip/cargo/actions, a CI pip-audit+cargo audit
job, a CycloneDX SBOM on release, and a scripts/reproduce.py reproducibility audit gated in CI.
R1 — the consent/license/checksum resolution wired for the backbone and every trained scorer through
a shared WeightGate, plus a backbone ONNX export path (export_onnx, dynamic batch/sequence
axes, opset 17) for portable inference (the trained forward pass and the export both stay
real_weights-gated), and each menu's provenance.models now records the card-backed
ModelCheckpoint of every model invoked (deduped, scoped to the eligible chemistries, rendered in
the report footer, and captured by the reproducibility golden). R2 — all three spec
kernels (bwt/kmer/haplotype) are now on their hot paths: a true-linear SA-IS
FM-index build, a native k-mer seed kernel, FM-index seed-and-extend wired into the engine's
reference scan (auto-engaged past 1 Mb, byte-identical to the linear scan), and a native
haplotype-walk kernel that materializes each common haplotype's alternative sequence (~4x, pinned
byte-for-byte to the Python fallback). R3 — the three external-tool adapters are now real behind
recorded-fixture tests: Cas-OFFinder (input-deck builder + legacy/bulge output parser +
injectable-runner cross-check), VEP (region-endpoint predictor with an injectable fetcher, MANE
selection, and (variant, assembly, transcript) caching), and HGVS (HgvsLibraryProjector over
the real hgvs/UTA/SeqRepo stack) — with live network/binary calls factored behind injection points
(live_integration-marked, opt-in, never run in CI). R4 — cohort-scale batch design
(design.design_many) streams a whole VCF/iterable through design with bounded memory (each
menu summarized then released; O(1) with on_result), a resumable JSONL run manifest (a re-run
skips recorded items), per-item failure isolation, and an optional thread-parallel path — fed by the
cyvcf2 fast path (variant.iter_vcf) that streams a VCF into the cohort (one record per concrete
ALT, multi-allelic split, non-PASS/symbolic dropped; injectable reader, CI-tested without htslib);
and content-addressed cross-run caches (alleleforge.cache) that memoize embeddings
(CachedEmbedder.persistent) and the reference off-target scan (OffTargetCache via
search(..., cache=...), safety-gated to the default-scorer reference-only case) to disk so a value
computed in one run is reused by the next; and a persistent, memory-mapped whole-genome FM-index
(genome.GenomeIndex) — driven by R2's native SA-IS so the on-disk build scales to whole
chromosomes, consumed by the engine via search(..., genome_index=...), built once and reused across
runs (parity-tested vs the per-call build; scale-tested on a downsampled chromosome in CI). R5 — the
calibration & generalization machinery: scoring.ConformalCalibrator recalibrates predictive
intervals to a target coverage with the finite-sample split-conformal guarantee (the regression
analog of isotonic), benchmark.generalization_gap quantifies the cross-cell-type generalization
gap (in-context vs held-out cell type, oriented so positive = worse), and
scripts/calibration_study.py regenerates the per-task-ECE + gap + recalibration report from
CRISPR-Bench (the real-data numbers fill in with R1); and the methods-preprint draft
(docs/paper/preprint.md) turns the outline into a full manuscript —
abstract, methods, benchmark design, the weight-free end-to-end results (reference-bias reproduction +
the split-conformal coverage table), and reproducibility — with the accuracy-vs-published numbers
marked [pending R1]; and reproducible SVG figures (alleleforge.viz, a dependency-free hand-rolled
renderer) for the reference-bias reproduction, conformal coverage, per-task ECE, and the generalization
gap — committed under docs/assets/figures/, embedded above and in the preprint, regenerated byte-for-byte
by make figures. The one remaining R0 item is pinning the real
artifact hashes, which requires freezing the published upstream artifacts; the consent gate already
refuses any null-hash fetch by design.
AlleleForge targets Python ≥ 3.11. The core install is deliberately light; heavy scientific, ML, and web stacks live in optional dependency groups so the base package installs fast and CI stays reliable.
# Core library (light: pydantic types, config, model-card parsing — no torch/numpy)
pip install alleleforge # once published to PyPI
# From source, with the optional groups you need
git clone https://github.com/clay-good/alleleforge
cd alleleforge
pip install -e ".[core,genome,variant,cli,ml,dev]"| Group | Pulls in | Needed for |
|---|---|---|
core |
polars, pyarrow, numpy | tabular I/O |
genome |
pyfaidx, pysam, cyvcf2, mappy, pyliftover | reference access, indexing (Phase 2) |
variant |
hgvs | HGVS resolution (Phase 4) |
cli |
typer | the aforge command-line interface (Phase 12) |
web |
fastapi, uvicorn, httpx | the web API + served frontend (Phase 13) |
ml |
torch, transformers, lightning, scikit-learn | real embedding backbones (Phase 6+); the uncertainty core needs none of these |
cas9-rs3 |
lightgbm, sglearn | the real trained Rule Set 3 SpCas9-efficiency model (no torch); see below |
docs |
mkdocs-material, mkdocstrings | documentation site |
dev |
ruff, mypy, pytest, hypothesis, maturin | development |
The performance kernels live in a PyO3 crate (aforge_native) built with
maturin. All three spec kernels are implemented, each behind a
correct pure-Python fallback and a byte-identical parity test, and each wired into its hot path:
| Kernel | What it does | Hot path | Parity test | Speedup |
|---|---|---|---|---|
bwt |
FM-index build/count/locate/pam_sites |
reference scan (PAM seed-and-extend) | test_native.py |
genome-scale |
kmer |
exact length-k seed positions |
seed prefilter (high-stringency scans) | test_kmer.py |
~2–4x / ~5–6x lookup |
haplotype |
apply a haplotype's variant set to a window | haplotype walk (stage 3 materialization) | test_haplotype_kernel.py |
~4x |
FMIndex.build(prefer_native=True) transparently uses the Rust index when the crate is present; the
k-mer and haplotype dispatchers do the same. AlleleForge imports and runs cleanly without the crate
(pure-Python mode); build it for the genome-scale path:
pip install maturin
cd rust && maturin develop --release # builds & installs aforge_nativealleleforge._native.NATIVE_AVAILABLE reports whether the compiled extension is present, and
alleleforge.genome.native_fm_available() whether the FM-index kernels specifically are built. The
native suffix array is built by SA-IS (sais.rs — Nong–Zhang–Chan induced sorting, O(n)) rather
than the direct sort's O(n² log n), which collapses on the long poly-A / poly-N runs and tandem
repeats real genomes are full of; the unique sentinel keeps the suffix array unique so the result
stays byte-identical to the direct sort — pinned directly (the exposed fm_suffix_array vs the
ground-truth direct sort, over textbook-pathological and fuzz inputs) and end-to-end (FM-index
count/locate parity over low-complexity and random-long inputs).
That linear-time build is what makes the whole-genome index practical:
genome.GenomeIndex.build_genome(reference) persists one content-addressed FM-index per contig (both
strands) to disk and memory-maps it, so a genome index is built once, survives across runs
(a re-run maps the cache instead of rebuilding), and never pins itself in RAM. The off-target engine
takes it directly — search(spacer, pam, reference=ref, genome_index=gi) — anchoring PAMs through the
persistent index instead of rebuilding one per call, with hits identical to the per-call path
(parity-tested) and the memory-mapped query path validated at scale on a downsampled chromosome in CI.
The end-to-end design pipeline is live:
alleleforge.design.design()resolves a variant, routes it to every eligible chemistry, enumerates and scores candidates, runs population-aware off-target, and returns a ranked, explained menu (see the designer section), and reporting & oligo output renders it to cloning-ready oligos, HTML, PDF, JSON, and TSV. The whole pipeline is driven from theaforgeCLI and the web API + browser UI, and the same scorers are graded by CRISPR-Bench. All fifteen build phases are complete; three runnable example notebooks execute in CI, and the release pipeline (PyPI · multi-arch Docker · GitHub Release) is wired and tag-triggered. The snippets below show the lower-level building blocks the designer composes.
from alleleforge.types import DNASequence, Prediction, UncertaintyMethod
seq = DNASequence("ACGTRYN") # validates IUPAC alphabet
print(seq.reverse_complement()) # ambiguity-aware: R↔Y, N↔N → "NRYACGT"
# Every numeric prediction carries a calibrated interval, never a bare float.
p = Prediction(value=0.72, interval=(0.61, 0.83), method=UncertaintyMethod.ENSEMBLE,
in_distribution=True)
print(p.interval_level) # 0.80 by default
print(p.calibrated) # False — the flag is unforgeable
# `calibrated=True` is a guarantee, not a self-report: a direct construction
# asserting it is coerced to False. Only a fitted calibrator can certify it,
# through the single authorized path, and never for an out-of-distribution input.
calibrated = Prediction.calibrated_by(value=0.72, interval=(0.61, 0.83),
method=UncertaintyMethod.CONFORMAL)
print(calibrated.calibrated) # TrueResolve a variant — every input form normalizes to one canonical, left-aligned record:
from alleleforge.variant import resolve, RawTarget
from alleleforge.types import DNASequence
# A raw target sequence with a marked edit — no reference file needed.
rv = resolve(RawTarget(sequence=DNASequence("ACGTAACGTACGT"), position=4, ref="A", alt="G"))
print(rv.variant) # target:4:A>G
print(rv.working_interval) # 0-based half-open analysis window around it
# With a reference genome, indels are left-aligned and the asserted ref is
# validated against the build (a mismatch is a hard error — likely wrong build):
# resolve("chr2:g.5226001del", reference=hg38, dbsnp=dbsnp_db)
# resolve("VCV000012345", clinvar=clinvar_db) # ClinVar accession → VariantInspect the data registry — every external dataset is versioned and license-aware:
from alleleforge.data import DEFAULT_REGISTRY
print(DEFAULT_REGISTRY.names) # ('1000g', 'clinvar', 'dbsnp', 'encode', ...)
clinvar = DEFAULT_REGISTRY.get("clinvar")
print(clinvar.version, clinvar.license) # 2024-05 public-domain (NCBI)
# Non-redistributable sources are never vendored; downloads are consent-gated
# and checksum-verified. See docs/data.md for the full provenance table.The same journey from the aforge CLI (pip install "alleleforge[cli]"):
# Variant → ranked, safety-annotated menu, rendered as an interactive HTML report
aforge design VCV000012345 --reference-fasta hg38.fa \
--intent correct --populations afr,eur,eas --format html --out report.html
# Standalone population/haplotype-aware off-target for a spacer. Every engine knob is
# tunable: the bulge budget, the CFD/MIT reporting thresholds, and the carrying MAF.
aforge offtarget GACGGAGGCTAAGCGTCGCAA --reference-fasta hg38.fa --pam NGG --json \
--dna-bulges 1 --rna-bulges 1 --cfd-threshold 0.20 --mit-threshold 0.10 --maf 0.001
# Normalize any input form and show its class (debugging aid)
aforge resolve chr2:100:A>G --jsonPhases 2–4 implement everything from an input to a validated, annotated variant with its genomic context — the foundation every modality plugs into.
flowchart LR
subgraph IN["Accepted inputs"]
A1["ClinVar accession"]
A2["dbSNP rsID"]
A3["HGVS g./c./p."]
A4["VCF record"]
A5["raw coordinates"]
A6["raw target seq"]
end
R["resolve()"]
subgraph NORM["Normalize"]
N1["left-align + trim<br/>(bcftools-norm)"]
N2["validate ref vs build<br/>(hard error on mismatch)"]
end
OUT["ResolvedVariant<br/>variant · working interval ·<br/>consequence · T2T recommendation"]
A1 & A2 & A3 & A4 & A5 & A6 --> R --> NORM --> OUT
R -. ClinVar/dbSNP/HGVS lookups .- DATA["Data registry<br/>(versioned, license-aware)"]
NORM -. fetch + flag ambiguous loci .- GEN["Genome access<br/>(FASTA, FM-index, liftover)"]
Coordinate convention cheat-sheet. Internals are uniformly 0-based half-open; only I/O boundaries are 1-based. Every parser converts on read.
| Surface | System | Converted by |
|---|---|---|
AlleleForge internals (GenomicInterval, Variant.pos) |
0-based half-open | — (canonical) |
| ClinVar / gnomAD / dbSNP VCF | 1-based | pos − 1 on read |
| GENCODE GTF | 1-based inclusive | [start − 1, end) on read |
| ENCODE bedGraph | 0-based half-open | unchanged |
HGVS (g.), human-readable reports |
1-based | boundary helpers only |
Dataset provenance (pinned, versioned, citation-stamped — full table in docs/data.md):
| Dataset | Version | License | Role |
|---|---|---|---|
| ClinVar | 2024-05 | Public domain | accession → variant + significance |
| gnomAD | v4.1 | CC0-1.0 | per-population allele frequencies |
| 1000 Genomes | phase 3 high-cov | Public (IGSR) | phased common haplotypes |
| HGDP | gnomAD v3.1 | CC0-1.0 | ancestry breadth |
| dbSNP | b156 | Public domain | rsID ↔ locus |
| GENCODE | v47 | Open | gene models / transcripts |
| ENCODE | 2024 | Open | chromatin tracks |
AlleleForge's safety core, and its clearest point of novelty: off-target nomination that is
reference-, population-, and haplotype-aware for every chemistry, behind one search() call that
returns an ancestry-stratified report. Reference-only off-target analysis has a known blind spot —
a minor allele can create a de novo PAM the reference never shows — and because allele frequencies
differ by ancestry, that blind spot concentrates risk in under-represented populations.
flowchart TB
SP["spacer + PAM"] --> S1
subgraph ENG["search() — five stages"]
direction TB
S1["1 · Reference scan<br/>PAM-anchored · ≤4 mismatch · ≤1 DNA + ≤1 RNA bulge · both strands<br/>FM-index seed-and-extend at genome scale (auto past 1 Mb)"]
S2["2 · Population augmentation<br/>gnomAD alt-allele re-scan → de-novo PAMs / strengthened seed sites"]
S3["3 · Haplotype walk<br/>common 1000G / HGDP haplotypes (variant combinations)<br/>native haplotype kernel materializes each alt sequence (~4x)"]
S4["4 · Patient VCF (optional)<br/>personalize to one genome"]
S5["5 · Score · threshold · de-dup · stratify"]
S1 --> S5
S2 --> S5
S3 --> S5
S4 --> S5
end
S5 --> R["OffTargetReport<br/>ancestry-stratified · every site tagged<br/>reference / population / patient + causal allele + freq"]
Every site records where it came from — the reference, a population variant (which allele, which
populations, at what frequency), or a patient's VCF — so a nomination can be audited, not trusted
blindly. The report's worst-case is computed against the worst-affected ancestry, never the
average, and it rolls every site into one aggregate genome-wide specificity score
(specificity_score(), see the cheat-sheet below).
A population is annotated as carrying a site only at or above the MAF safety threshold — applied
identically on the population-variant and haplotype paths, so the per-ancestry stratification can never
attribute a site's burden to a population that merely shows a trace, sub-threshold frequency. The
populations and ancestries provenance on each site are the same carrying set, by construction.
Note
k-mer seed acceleration (R2). The scan carries an optional, proven-equivalent k-mer
seed-and-extend prefilter (native Rust kernel + pure-Python fallback): by the pigeonhole bound, any
in-budget alignment shares an exact length-k seed with the spacer, so anchors whose window contains
no seed can be skipped without ever dropping a hit (an exhaustive randomized test pins seeded ≡
brute-force). It auto-engages only when the seed is selective (k ≥ 5, i.e. high-stringency / low
edit-budget scans) — measured ~2–4x there (scripts/native_speedup.py) —
and is a transparent no-op at the default ≤4-mismatch+bulge budget, where the FM-index remains the
genome-scale path. See SPEC_V2.md R2.
Note
FM-index seed-and-extend on the reference scan (R2, landed). Stage 1 now anchors PAMs through a
content-addressed FM-index (search(..., use_fm_index=...)): each concrete PAM is located in the
index (the PAM is the seed) and only those anchors are extended by the shared alignment, replacing
the linear O(n) PAM pass. It returns byte-identical hits to the brute-force scan — pinned by a
randomized parity test at both the scan_sequence and search levels — and auto-engages per
region past 1 Mb (FM_INDEX_AUTO_THRESHOLD), so genome-scale contigs take the indexed path while
small inputs stay on the linear scan.
The canonical cautionary tale is the BCL11A enhancer variant rs114518452 (Cancellieri & Pinello,
Nat Genet 2023). AlleleForge reproduces it as an integration test: a reference-only scan returns
zero sites, while the population-aware scan nominates the high-CFD off-target the minor allele
creates — ancestry-stratified, with its African-ancestry-enriched frequency recorded.
from alleleforge.offtarget import search
from alleleforge.types.guide import PAM
report = search(spacer, PAM(pattern="NGG"), reference=hg38, gnomad=gnomad_db)
for site in report.sites:
print(site.origin, round(site.score, 2), site.causal_allele, site.populations)
worst = report.worst_ancestry() # ('afr', 1.0) — flagged, not averaged away
spec = report.specificity_score() # aggregate genome-wide specificity in (0,1], 1.0 = cleanEvery figure in this README is regenerated byte-for-byte from the weight-free,
deterministic pipeline by python scripts/figures.py — committed SVGs, no plotting
dependency (the same hand-rolled-renderer discipline as the PDF report).
| Score | Source | Status in AlleleForge |
|---|---|---|
| MIT / Hsu | Hsu et al., Nat Biotechnol 2013 | Exact — published 20-position weight table |
| CFD | Doench et al., Nat Biotechnol 2016 | Published PAM table; mismatch weights default to a transparent seed model, injectable with the exact Doench matrix |
| CFD-Cas12a | analog | Seed at the PAM-proximal 5' end, TTTV PAM |
Those score one site. The report also rolls every site into one aggregate genome-wide specificity
score — report.specificity_score(), the CFD-scale analog of the Hsu 2013 / MIT guide score
100/(100+Σ), i.e. 1/(1 + Σ site scores) ∈ (0, 1], 1.0 for a guide with no off-targets and
decreasing as the total burden grows. It is the single number every design tool headlines, and unlike the
worst-case it distinguishes two guides with the same worst site but a different number of off-targets.
It surfaces on every output surface that summarizes off-target: the HTML/PDF report and the
CandidateReport.offtarget_specificity export field, the standalone aforge offtarget command and its
POST /api/offtarget web equivalent (both alongside the site count and worst-case score), and the cohort
batch summary (best_specificity), so triage can rank by total burden, not just the single worst site.
All three site scores sit behind one swappable OffTargetScorer protocol, so a Phase 6 ML scorer drops in
without touching the engine. Reporting thresholds default to CFD ≥ 0.20 or MIT ≥ 0.10 — an OR, so
a site can be nominated on its MIT score even when its CFD is sub-threshold. So that a nomination stays
auditable, every site records both: the primary score (under score_method) and the companion
mit_score (OffTargetSite.mit_score, None when MIT is undefined — a bulged or non-20-nt alignment).
The MIT score that retained a low-CFD site is therefore visible in the serialized report, never silently
dropped.
The genome-scale search is the FM-index seed-and-extend path (native Rust
bwtkernel when built, a correct pure-Python FM-index otherwise — byte-identical, pinned by parity tests; CI never blocks on the native build). It is wired into the engine's reference scan and auto-engages on large contigs.
AlleleForge is independent of external tools but integrates them at the seams, each behind a
swappable interface so its absence degrades gracefully and its presence adds a cross-check or a
richer annotation. Every adapter is tested against recorded fixtures; only the live network/binary
call is opt-in (live_integration-marked, never run in CI).
| Adapter | Role | Pure (CI-tested) | Live (opt-in) |
|---|---|---|---|
| Cas-OFFinder | off-target cross-check vs. the native engine | input-deck builder, legacy/bulge output parser, disagreements() |
the binary subprocess (injectable runner) |
| VEP (Ensembl REST) | molecular consequence for chemistry routing | parse_vep_response (MANE/canonical selection, SO term → impact), (variant, assembly, transcript) cache |
the region-endpoint GET (injectable fetcher) |
HGVS (hgvs/UTA/SeqRepo) |
c./p. ⇄ g. projection |
dependency-free g. parser; import-guarded HgvsLibraryProjector |
AssemblyMapper.c_to_g against UTA |
Disagreements are surfaced as flags, never hidden: a Cas-OFFinder locus the native engine misses (or vice versa) is reported, not silently dropped.
Before any chemistry-specific predictor, AlleleForge establishes the reusable ML substrate: a
license-gated model zoo, a swappable embedding backbone, and the calibrated-uncertainty
machinery that realizes the honest-uncertainty principle. The whole substrate is pure stdlib in its
core path — no numpy or torch — so it runs in CI on a weight-free stub embedder; real 500M-parameter
backbones are gated behind the real_weights marker.
flowchart LR
SEQ["DNA sequence"] --> EMB["SequenceEmbedder<br/>(NT v2 · Caduceus · Evo 2 · Stub)"]
EMB --> CACHE["embedding cache<br/>(by sequence hash)"]
EMB --> OOD["OODDetector<br/>distance vs training reference"]
CACHE --> MODEL["scorer / ensemble"]
MODEL --> U{"uncertainty"}
U -->|N=5 default| ENS["deep ensemble<br/>mean ± z·σ (disagreement)"]
U -->|fallback| EV["evidential<br/>aleatoric + epistemic"]
U -->|if quantiles| QT["quantile interval"]
ENS & EV & QT --> CAL["isotonic calibration<br/>(reduces ECE)"]
OOD --> CAL
CAL --> PRED["Prediction[float]<br/>value · 80% interval · method ·<br/>in_distribution · calibrated"]
No bare floats. Every scorer returns a Prediction, never a number; ensure_prediction is the
runtime guard at the orchestration seam. No undocumented models. Every checkpoint loads through the
model zoo, which refuses a missing card, a license that forbids the use, or an unverifiable hash, and
surfaces a ModelCheckpoint into result provenance.
Consent-gated real weights (R1). Every trained model — the sequence backbone and the
per-chemistry adapters (cas9 efficiency/outcome, base-edit outcome, prime efficiency) — resolves its
weights through one shared gate, model_zoo.loader.WeightGate, not a bare from_pretrained:
resolve_weights() runs the license gate (the default Nucleotide Transformer v2 is CC-BY-NC-SA
and the trained adapters are research-only — all refused for commercial use), requires explicit
consent before any download, checksum-verifies a pinned artifact, and records the resolved
ModelCheckpoint for provenance (e.g. EnsembleEfficiencyScorer.backbone_checkpoint()). The whole
consent/license/checksum flow is exercised in CI with an injected downloader — no network, no torch;
only the tensor load / forward pass itself stays behind the real_weights marker. Every model ships a
bundled, license-gated card. Each menu's provenance.models records the card-backed ModelCheckpoint
of every model invoked — deduped, scoped to the chemistries that ran, and rendered in the HTML/PDF
report footer — so a result names the exact models that produced it. The checkpoint carries the card's
known_failure_modes alongside its name, version, license, and citation, so the provenance is
self-contained for safety audit: a consumer can check a design against what each model is documented
to get wrong without re-opening the cards. See SPEC_V2.md R1.
| Method | Role | Interval |
|---|---|---|
| Deep ensemble (N=5) | default | mean ± z·σ from member disagreement — widens on OOD |
| Evidential (NIG) | single-model fallback | splits aleatoric (data) vs epistemic (model) variance |
| Quantile | when the model emits quantiles | read off the (1±level)/2 quantiles |
| Isotonic calibration | post-hoc, recalibrates probabilities | PAV fit; expected_calibration_error quantifies the gain |
| Conformal recalibration | post-hoc, recalibrates intervals | split-conformal width scale to a target coverage (finite-sample guarantee); empirical_coverage flags when it's needed |
from alleleforge.scoring import DeepEnsemble, ensemble_prediction, OODDetector, StubEmbedder
ens = DeepEnsemble([m1, m2, m3, m4, m5]) # five members
emb = StubEmbedder().embed(["GACCATGCAACCTTGAACGT"])[0] # NT v2 in production
ood = OODDetector(training_reference) # embedding-space density
pred = ensemble_prediction(ens.predict(features), in_distribution=ood.is_in_distribution(emb))
print(pred.value, pred.interval, pred.method, pred.in_distribution) # honest by constructionThe most mature chemistry, and the right one to prove the full vertical slice end to end. From a
resolved variant, design_cas9 enumerates guides, scores efficiency and outcome with calibrated
uncertainty, runs the population-aware off-target engine, and returns ranked candidates.
flowchart LR
V["ResolvedVariant<br/>+ intent"] --> EN["enumerate_cas9<br/>PAM-anchored · strand-aware ·<br/>cut 3 bp 5' of PAM · actionable window"]
EN --> EF["efficiency<br/>RS3 baseline / deep ensemble<br/>(80% interval + OOD)"]
EN --> OUT["outcome<br/>microhomology / MMEJ +<br/>1-bp insertion spectrum"]
EN --> OT["off-target<br/>(Phase 5 engine,<br/>ancestry-stratified)"]
EF & OUT & OT --> C["DesignCandidate[]<br/>ranked: efficiency then safety"]
EN -.precise intent.-> HDR["HDR donor template"]
Defaults & decisions. Primary PAM NGG; NG (SpCas9-NG) and NRN/NYN (SpRY) are emitted only
when no NGG guide is actionable and opted in. Cut site 3 bp 5' of the PAM. The actionable window
is tight around the edit for precise intents (HDR efficiency falls off with cut-to-edit distance) and
the whole working interval for a knock-out, which marks frameshift outcomes as intended.
| Axis | Default (CI, weight-free) | Trained alternative (model zoo) |
|---|---|---|
| Efficiency | RS3-style feature heuristic + backbone deep ensemble | Rule Set 3 (real, wired — cas9-rs3); fine-tuned NT v2 ensemble (ml) |
| Outcome | microhomology/MMEJ + 1-bp insertion model | inDelphi (default) · Lindel · X-CRISP + agreement |
| Off-target | Phase 5 engine (pure-Python fallback) | Phase 5 engine (Rust FM-index) |
Note
Heuristic vs. trained, stated honestly. The weight-free defaults that run in CI are heuristic
baselines (method=HEURISTIC, calibrated=False) — transparent feature models, not the published
networks. The first real trained model is now wired: TrainedRuleSet3Scorer
resolves the published Rule Set 3 LightGBM model through the consent-gated, checksum-verified model
zoo (as a version-independent text booster) and reproduces upstream rs3.predict_seq bit-for-bit
(parity-tested). It is opt-in (pip install "alleleforge[cas9-rs3]", no torch) and gated behind the
real_weights marker so CI stays weight-free. The trained prime/base-editing networks remain
heuristic baselines for now; see specs/model-integration.md for the
roadmap.
Every efficiency score carries an 80% interval and an OOD flag; every outcome is a normalized distribution over indel alleles; every candidate carries an ancestry-stratified off-target report — so a ranked menu is honest about what it does and does not know.
Base editors install a single transition (ABE: A·T→G·C; CBE: C·G→T·A) without a double-strand break, within a narrow activity window. The hard part is the window outcome: of the editable bases in the window, which get edited — and what bystanders ride along. AlleleForge enumerates every sgRNA placing the target base in-window per editor, predicts the window-allele distribution, and ranks by the probability of the exact intended allele while minimizing bystander burden.
flowchart LR
V["ResolvedVariant<br/>(transition SNV)"] --> EL{"editor eligible?<br/>ABE: A·T→G·C<br/>CBE: C·G→T·A"}
EL --> EN["enumerate_base_edits<br/>target base in window 4–8 ·<br/>strand-aware · bystanders flagged"]
EN --> WO["window outcome<br/>per-position p(edit) × motif →<br/>2ᵏ allele distribution"]
WO --> M["p_intended_exact<br/>+ bystander_burden"]
EN --> OT["off-target<br/>(Phase 5, ancestry-stratified)"]
M & OT --> C["DesignCandidate[]<br/>ranked: clean-edit then bystander<br/>cleanest = recommended"]
Declarative editor registry. ABE8e, CBE4max, and evoCDA1 ship as data; adding an editor (deaminase, chemistry, window, PAM, motif preference) is a one-descriptor change, not code.
| Editor | Deaminase | Edit | Window | Motif preference |
|---|---|---|---|---|
| ABE8e | TadA-8e | A→G | 4–8 | none (broad) |
| CBE4max | APOBEC1 | C→T | 4–8 | TC (prefers 5′ T) |
| evoCDA1 | evoCDA1 | C→T | 2–10 | none (broad window) |
Every candidate carries the tradeoff explicitly — the bystander-present:N / clean flag, the full
window-allele distribution, an ancestry-stratified off-target report, and a calibrated
bystander_burden (the expected number of bystander edits, with an 80% interval) persisted as a
structured field on the candidate. The burden the ranking minimizes is therefore exportable, not just
printable: it rides through the JSON/TSV/Parquet exports (a bystander_burden column), the HTML/PDF
reports, and the cohort batch summary (best_bystander_burden), alongside the p_intended_exact it is
ranked against. The recommendation is the cleanest editor/guide combination, not just the first one found.
Prime editing is the chemistry where AlleleForge contributes the most. PRIDICT2.0 is SOTA for efficiency but has no variant front-end and no off-target module; PrimeDesign/PrimeVar give ClinVar-to-pegRNA but only rule-based scoring and reference-only off-target; CRISPRme does population off-target but designs no pegRNAs. AlleleForge stitches all four axes together and fills the seams.
flowchart LR
V["ResolvedVariant + intent"] --> EN["enumerate_prime"]
EN --> G["pegRNA geometry:<br/>nick · PBS 8-17 · RTT 7-34 (edit + >=5 homology) ·<br/>tevopreQ1 epegRNA · PE3/PE3b nick"]
G --> EF["efficiency<br/>PRIDICT2.0-style + ePRIDICT<br/>(80% interval, OOD flag)"]
G --> OUT["outcome<br/>intended vs. byproduct<br/>(scaffold / partial RTT / indel)"]
G --> OT["off-target on BOTH nicks<br/>pegRNA nick + ngRNA nick<br/>merged, ancestry-stratified"]
EF --> C["DesignCandidate[] (ranked)"]
OUT --> C
OT --> C
| Axis | PRIDICT2.0 | PrimeDesign / PrimeVar | CRISPRme | AlleleForge |
|---|---|---|---|---|
| Therapeutic variant front-end | no | yes | no | yes |
| ML efficiency + calibrated uncertainty | yes | no | no | yes |
| Outcome / byproduct prediction | partial | no | no | yes |
| Population-aware off-target | no | no | yes | yes |
Honest by construction. PRIDICT2.0 is trained on HEK293T/K562; any other cell context flags the
efficiency prediction out-of-distribution and raises an ood flag rather than hiding it. The
off-target engine runs on the pegRNA nick and the ngRNA nick, merging into one ancestry-stratified
report. The PE3b nicking guide is preferred when a seed-disrupting ngRNA exists (it nicks only the
edited strand, suppressing indels). See the canonical journey end to end in
examples/01_clinvar_to_design.ipynb.
Note
Default vs. real PRIDICT2.0. The built-in PridictScorer is a transparent heuristic
geometry baseline (method=HEURISTIC) — it is not the trained network. The real PRIDICT2.0 is now
wired as an opt-in, sequence-level engine: PridictEngineAdapter
shells out to a local PRIDICT2 checkout (Mathis et al. 2024, MIT), runs its attention-RNN ensemble +
DeepCas9 pipeline, and returns ranked pegRNA designs each carrying a calibrated efficiency. Because
PRIDICT2 ships as a Git repo (not a PyPI package) and pins TensorFlow 2.13 + PyTorch 2.0.1 (which
conflict with AlleleForge's own deps), the adapter invokes PRIDICT2 in its own environment — point
it there with ALLELEFORGE_PRIDICT2_REPO / ALLELEFORGE_PRIDICT2_PYTHON. It is gated behind the
real_weights marker and parity-tested against captured PRIDICT2 output, so CI stays weight-free. See
specs/pridict2-integration.md.
The keystone that realizes the variant-first promise end to end. design() takes any input form, decides
which chemistries can biologically make the edit, generates and scores candidates from each, ranks them on
one footing, and returns an explained RankedMenu with a Pareto front and full provenance.
flowchart LR
V["variant input<br/>(any form)"] --> R["resolve()"]
R --> RT["route()<br/>transparent rules:<br/>variant class + intent"]
RT --> ABE["base ABE/CBE<br/>(transition SNV)"]
RT --> PE["prime<br/>(precise small edit)"]
RT --> NUC["nuclease<br/>(disruption intent)"]
ABE & PE & NUC --> RANK["rank_candidates()<br/>weighted sum + Pareto front"]
RANK --> M["RankedMenu<br/>ordered · rationale ·<br/>Pareto front · provenance"]
Routing is transparent and inspectable. Each rule is a chemistry paired with a one-line biological
rationale and a pure (resolved, intent) predicate. Adding or relaxing a rule is a one-line data change,
and route() explains every verdict — kept and dropped.
| Chemistry | Eligible when | Biological reason |
|---|---|---|
| Base editing (ABE) | transition SNV, required change A:T→G:C |
one in-window transition, no double-strand break — the cleanest fix |
| Base editing (CBE) | transition SNV, required change G:C→A:T |
same, complementary transition |
| Prime editing | any precise small edit (≤ RTT length), non-disruptive intent | arbitrary substitutions / short indels from an RTT template, no break |
| SpCas9 nuclease | disruption (knock-out) intent | a break repaired by NHEJ yields frameshifting indels |
Ranking puts every chemistry on one footing. Candidates are projected onto four shared, higher-is-better objectives and ordered by a transparent weighted sum, with the Pareto front always exposed for users who weight differently.
| Objective | Definition | Default weight |
|---|---|---|
| Efficiency | uncertainty-discounted on-target efficiency (point estimate in-distribution, lower interval bound out-of-distribution) | 0.35 |
| Cleanliness | probability mass on the intended allele | 0.30 |
| Safety | 1 − off-target score of the worst-affected ancestry |
0.30 |
| Simplicity | reagent simplicity (single sgRNA > pegRNA + nick + motif) | 0.05 |
The efficiency term is uncertainty-aware: an out-of-distribution prediction is ranked on its lower interval bound, so a confident-looking OOD candidate cannot outrank an otherwise-equal in-distribution one, and each candidate's interval and OOD status appear in its score breakdown. The safety term uses the worst-affected ancestry, never the average, so a guide safe on average but dangerous in one population is correctly down-ranked. The designer degrades gracefully: an unavailable model, a failing enumeration, or a chemistry that finds nothing is recorded with its reason in the menu rationale while the rest of the menu still returns.
from alleleforge.design import design, eligible_chemistries
from alleleforge.types.edit import EditIntent
# Which chemistries can even make this edit?
print(eligible_chemistries(resolved, EditIntent.CORRECT)) # [BASE_CBE, PRIME]
# One call: resolve → route → enumerate → score → off-target → rank.
menu = design("VCV000012345", reference=hg38, clinvar=clinvar_db,
intent=EditIntent.CORRECT, populations=["afr", "eur", "eas"])
best = menu.best
print(best.chemistry, best.rationale) # includes the score breakdown
print(menu.pareto_front) # trade-off-optimal candidates
print(menu.provenance.seed) # reproducible to the byte
print([m.name for m in menu.provenance.models]) # every model invoked, e.g. ['be-dict', 'pridict2']design_many is the cohort multiplier over design, built so a whole VCF is no different from three
rows: it streams the input (bounded memory — each menu is summarized then released), is
resumable (a JSONL run manifest a re-run skips past), and isolates per-item failures (an
unresolvable variant is recorded, not fatal). variant.iter_vcf is the cyvcf2 fast path that
produces the lazy stream straight from a VCF.
from alleleforge.design import design_many
from alleleforge.variant import iter_vcf
report = design_many(
iter_vcf("cohort.vcf.gz"), # streams a VCF: one record per concrete ALT, multi-allelic split,
# symbolic/spanning alleles skipped, non-PASS dropped by default
reference=hg38, intent=EditIntent.INSTALL,
manifest_path="run.jsonl", # resume point: a re-run skips items already recorded
output_dir="menus/", # durable per-sample menu JSON (survives the run)
on_result=print, # stream results → O(1) memory in cohort size
)
print(report.succeeded, report.failed, report.skipped)iter_vcf also accepts any iterable duck-typed to the cyvcf2 Variant shape (a region query, a
generator, a test list), so the whole pipeline is testable without the native htslib dependency; a
path open names the genome extra in a clear error when cyvcf2 is absent.
The same cohort run is one command from the aforge CLI —
the batch subcommand auto-detects a VCF (cyvcf2 fast path) vs a one-variant-per-line list:
# Whole-VCF cohort → resumable run, durable per-sample menus, a per-item TSV summary
aforge batch cohort.vcf.gz --reference-fasta hg38.fa --intent correct \
--manifest run.jsonl --output-dir menus/ --summary-tsv summary.tsv --max-workers 8
# Summary columns: best_chemistry · best_efficiency · best_bystander_burden · worst_offtarget · best_specificity · n_candidates…and over HTTP from the web API: POST /api/batch takes a JSON
variant list and returns the same per-item summaries with provenance — cohort design reaches all three
audiences (library, CLI, web) over one core.
| Guarantee | How |
|---|---|
| Bounded memory | input consumed lazily; only the per-item menu is held, then released (on_result ⇒ O(1)) |
| Resumable | JSONL run manifest with a provenance header; a re-run skips recorded item_ids |
| Failure-isolated | a per-variant error is captured in the manifest; the cohort continues |
| Parallel (safe) | max_workers + a reference_factory (a pyfaidx handle is not thread-safe to share) |
| VCF fast path | iter_vcf(path) streams a VCF (cyvcf2), splitting multi-allelic rows and dropping non-PASS/symbolic calls — injectable, so CI-tested without htslib |
| Auditable | CohortRunReport carries run counts + provenance (version, seed, build, intent) |
A cohort recomputes the same embeddings and the same reference scans constantly. alleleforge.cache
is the cross-run memo: a sharded, atomically-written (temp-then-rename) disk key/value store under
the cache dir, keyed by the SHA-256 of the inputs that determine the result, so a value computed in
one run is reused by the next.
| Cache | Key | How to use | Safety |
|---|---|---|---|
| Embeddings | sequence hash, scoped per backbone identity | CachedEmbedder.persistent(embedder) |
content-addressed; two backbones never collide |
| Off-target | spacer · PAM · budget · thresholds · reference (build + contig lengths) · regions | search(..., cache=OffTargetCache()) |
only the default-scorer, reference-only case is cached — gnomAD/haplotype/patient or a custom scorer bypasses it, so a danger scan is never served stale |
A wrong off-target report is a missed danger, so the off-target cache refuses to key anything it cannot fully capture: a changed budget/PAM/threshold/reference is a new key, and any population/haplotype/patient augmentation skips the cache entirely.
A ranked menu is only useful if a bench scientist can order it and a pipeline can
parse it. Phase 11 turns a RankedMenu into the artifacts users actually consume —
cloning-ready oligos, a structured report model, machine-readable exports, an
interactive HTML page, and a static print-ready PDF — every render leading
with the research-use disclaimer and ending with full provenance. The whole phase
is dependency-free: no plotting library, no PDF toolchain, nothing for CI to
flake on.
flowchart LR
M["RankedMenu"] --> B["build_report()"]
B --> R["DesignReport<br/>disclaimer · candidates · provenance"]
R --> OL["oligos_for()<br/>annealed duplexes, round-trip-checked"]
R --> J["JSON / TSV / Parquet<br/>(machine-readable)"]
R --> H["render_html()<br/>interactive Plotly, ancestry tables"]
R --> P["render_pdf()<br/>print-ready, pure-Python"]
Cloning oligos round-trip by construction. oligos_for(candidate) dispatches
by chemistry; the cardinal invariant — enforced on build and re-checked by
reconstruct() — is that the oligos rebuild the intended spacer / RTT / PBS. A
design whose oligos do not reconstruct is a cloning error caught before synthesis.
| Chemistry | Oligos emitted | Default scheme |
|---|---|---|
| SpCas9 sgRNA | one duplex (vector 5' overhangs + U6 G) |
lentiGuide BsmBI |
| Base-editor sgRNA | one duplex (standard sgRNA) | lentiGuide BsmBI |
| pegRNA | spacer duplex + 3' extension (RTT + PBS + epegRNA motif) + ngRNA duplex | pegRNA GG BsaI |
Honest rendering. HTML charts are interactive Plotly figures pulled from a CDN with each figure's spec inlined as JSON — so no Python plotting dependency is needed and no sequence data leaves the page. Off-target tables are ancestry-stratified, surfacing the worst-affected population per candidate. The PDF is a small self-contained writer (no weasyprint / reportlab) for a clean leave-behind.
from alleleforge.report import build_report, render_html, render_pdf, report_to_tsv
report = build_report(menu, variant="chr11:5226778:T>A", intent="correct")
open("report.html", "w").write(render_html(report)) # interactive, self-contained
open("report.pdf", "wb").write(render_pdf(report)) # static, print-ready
open("menu.tsv", "w").write(report_to_tsv(report)) # one row per candidate
report.best.oligos.reconstruct() # ('spacer', 'rtt', 'pbs')A thin, reproducible, config-driven Typer shell over the library — no
business logic of its own. Every command resolves its inputs, calls the same functions the Python API
exposes, and can emit machine-readable JSON. Install with pip install "alleleforge[cli]".
flowchart LR
CFG["--config run.toml<br/>+ CLI flags + --seed"] --> CMD
CMD["aforge subcommand"] --> RES["resolve"]
CMD --> DES["design"]
CMD --> BAT["batch (cohort)"]
CMD --> OT["offtarget"]
CMD --> DAT["data list/show"]
DES --> R["library: resolve → design → report"]
BAT --> MANY["library: iter_vcf → design_many"]
MANY --> SUM["per-item summary (TSV/JSON)<br/>+ JSONL manifest · menus/"]
R --> OUT["JSON · TSV · HTML · PDF<br/>+ .provenance.json sidecar"]
| Command | Purpose |
|---|---|
aforge resolve <input> |
Normalize any input form; show the canonical variant + class. |
aforge design <input> |
Variant → ranked, multi-chemistry menu rendered to JSON/TSV/HTML/PDF. |
aforge batch <vcf|list> |
Cohort design over a VCF (cyvcf2 fast path) or variant list — streaming, resumable, failure-isolated. |
aforge offtarget <spacer> |
Standalone population/haplotype-aware off-target search. |
aforge data list / show <name> |
Inspect the dataset registry (versions, licenses, provenance). |
aforge bench list / run |
List and run CRISPR-Bench tasks against frozen splits. |
aforge bench leaderboard <result.json…> |
Aggregate signed results into the model-card-gated leaderboard (Markdown/HTML). |
Global options sit before the subcommand (--seed, --reference, --cache-dir, --verbose,
--version); every command takes --json. Exit codes are distinct and scriptable: 0 success,
2 usage/input error, 3 missing data (e.g. reference FASTA not found), 4 an unavailable model or
feature. A run is reproducible from its echoed --seed + config (byte-identical modulo the UTC
timestamp), and a <output>.provenance.json sidecar is written next to every file output.
# Reproducible design from a config file; CLI flags override the file
aforge --seed 20240501 design chr2:71:A>C \
--reference-fasta hg38.fa --config run.toml \
--chemistry prime --weights 0.5,0.2,0.2,0.1 --format html --out report.html
# → wrote report.html and report.html.provenance.jsonThe accessible front door for users who will not touch a terminal: a FastAPI backend that exposes the
library over HTTP, and a dependency-free served single-page frontend that drives the variant-first
journey in the browser — with a single-variant tab and a cohort (batch) tab that posts a variant
list to /api/batch and renders the per-item summary table. The app is a thin async layer with no
business logic of its own — it validates each request with a pydantic model, calls the same functions the
Python API and CLI use, and returns a Phase 1 / Phase 11 schema-validated response, with OpenAPI
auto-generated at /docs.
flowchart LR
B["Browser SPA<br/>(served, no Node build)<br/>single · cohort tabs"] -->|POST /api/design · /api/batch| API
CURL["curl / httpx / any client"] -->|JSON| API
subgraph API["FastAPI app (local)"]
EP["resolve · design · batch · offtarget<br/>data · bench · health · jobs"]
JQ["in-process async job queue<br/>(thread worker + progress)"]
EP --> LIB
JQ --> LIB
end
LIB["library: resolve → design → report"] --> OUT["JSON · HTML · PDF<br/>(Phase 1 / Phase 11 schemas)"]
Important
Local, private, no egress. All compute is local and user-controlled. The app makes no outbound network call and transmits no sequence data externally — a guarantee enforced by a test that fails if any socket connects during a design request. The served frontend says so prominently and loads no third-party scripts.
| Method & path | Purpose |
|---|---|
GET /api/health |
Liveness, reference status, disclaimer |
POST /api/resolve |
Normalize any input form to a canonical variant |
POST /api/design |
Variant → ranked menu; ?format=json|html|pdf |
POST /api/jobs/design → GET /api/jobs/{id} |
Async job submit + status/progress/result |
POST /api/batch |
Cohort design over a variant list; per-item summaries + provenance, failures isolated |
POST /api/offtarget |
Standalone population-aware off-target search — full report plus the aggregate summary (site count, worst-case, specificity) |
GET /api/data · /api/data/{name} |
Inspect the dataset registry |
GET /api/bench |
List the CRISPR-Bench tasks, datasets, and primary metrics |
GET / |
The served single-page frontend |
# One-command local deploy (reference FASTA mounted at ./data/reference.fa)
docker compose up --build # → http://localhost:8000 · /docs for OpenAPI
# Or run directly
pip install "alleleforge[web]"
ALLELEFORGE_REFERENCE_FASTA=hg38.fa uvicorn alleleforge.web.api.app:app --port 8000
# Cohort design over HTTP: post a variant list, get per-item summaries + provenance
curl -s localhost:8000/api/batch -H 'content-type: application/json' \
-d '{"variants": ["chr2:71:A>C", "VCV000012345"], "intent": "correct"}'The async job worker is in-process (the default deployment is single-user and local), so no broker or
separate worker container is needed; a multi-user deployment can swap in a real broker behind the same
JobManager interface. The served vanilla-JS frontend (single-variant + cohort tabs) ships inside the
wheel and is exercised end to end by the API tests; a production Next.js + JBrowse 2 frontend can replace
it behind the same API unchanged.
The sister deliverable and a field-level contribution in its own right: a common yardstick for guide- and
edit-design models — versioned datasets, frozen content-hashed splits, a fixed five-task contract, a
metric battery where calibration is required on every task, a runner that turns any Scorer into a
signed result, and a model-card-gated leaderboard. It is valuable independently of the rest of
AlleleForge, and the same scorers the designer uses are graded by it.
flowchart LR
DS["datasets/<br/>provenance-stamped,<br/>content-hashed"] --> SP
SP["splits/<br/>frozen · cross-context<br/>hash-verified on read"] --> RUN
SC["any Scorer<br/>(returns a calibrated<br/>Prediction)"] --> RUN
RUN["runner<br/>metrics + ECE"] --> RES["signed, provenance-<br/>stamped result"]
RES --> LB["leaderboard<br/>(model-card gated)"]
The five tasks — every chemistry AlleleForge designs for, plus off-target. Each reports its accuracy metric and Expected Calibration Error, because a model that is accurate but overconfident is dangerous for edit design:
| Task | Kind | Source corpus | Primary metric | + required |
|---|---|---|---|---|
cas9-efficiency |
regression | Rule Set 3, DeepHF/DeepSpCas9 | Spearman | Pearson, ECE |
cas9-outcome |
distribution | FORECasT, inDelphi, Lindel | KL ↓ | top-1, ECE |
be-outcome |
distribution | BE-Hive, BE-DICT | KL ↓ | top-1, ECE |
pe-efficiency |
regression | PRIDICT2 Library-Diverse | Spearman | Pearson, ECE |
offtarget-classification |
classification | GUIDE-seq / CHANGE-seq | AUROC | AUPRC, ECE |
Frozen, content-hashed, cross-context splits. A split is immutable once published. Each split file pins
its fold membership and two hashes — one over the dataset content it was cut from, one over its own
membership — and load_split() re-verifies both on read, raising SplitIntegrityError on any drift.
Changing the data, or the split, means minting a new version; you never edit a published one. Test folds
hold out a whole cell context, so the benchmark measures generalization, not memorization — the known
weak spot of guide models, made a headline feature instead of a footnote. benchmark.generalization_gap
turns that into a number: a model's primary metric on an in-context fold vs the held-out cell type,
oriented so a positive gap means worse generalization (R5; reported in the calibration study).
Honest by construction. Results are content-addressed (signature) so a published number cannot be
silently edited, and the leaderboard refuses any submission lacking a model card (name, license, citation) or
carrying a bad signature — aforge bench leaderboard *.json aggregates signed results into the board
(Markdown/HTML), enforcing both gates on read. The regression-task ECE is interval-coverage calibration
(|empirical coverage − nominal|), and because that is only well-defined against a single nominal level it
is computed per interval_level and count-weighted — a scorer that mixes interval levels in one batch is
scored correctly, never pooled against one prediction's level. The shipped datasets are small synthetic fixtures so the
whole benchmark runs in CI with no downloads; the real corpora are fetched at runtime through the same
consent-gated registry as the population data. See
src/alleleforge/benchmark/README.md.
aforge bench list # the five tasks, datasets, and metrics
aforge bench run cas9-efficiency # score the reference baseline on the frozen split
aforge bench run pe-efficiency --out result.json # signed, provenance-stamped result JSON
aforge bench leaderboard *.json --format html --out board.html # model-card-gated boardfrom alleleforge.benchmark import build_baseline, get_task, load_split, run_benchmark
task = get_task("offtarget-classification")
split, dataset = load_split(task.name) # hash-verified on read
result = run_benchmark(build_baseline(task, split, dataset), task, split=split, dataset=dataset)
print(result.primary_metric, round(result.primary_value, 3), "ece", round(result.metrics["ece"], 3))
assert result.verify_signature()Note
The benchmark lives at alleleforge.benchmark (an installed subpackage) rather than the spec's sketched
top-level benchmark/ tree, so it ships in the wheel, is reachable from aforge bench, and is held to the
same mypy --strict / ruff / coverage gates as the rest of the library.
Calibration & generalization, at a glance. Every task reports its ECE, and the cross-cell-type gap is a first-class number. The figures below are computed on the weight-free splits — they verify the machinery (the metric battery, the split mechanics, the generalization-gap computation), not model quality, which awaits the real-weights integration (R1). Split-conformal recalibration restores interval coverage to its nominal target with a finite-sample guarantee.
Three notebooks walk the journey end to end. Each is self-contained — it builds a small synthetic
locus and runs against the weight-free stub models — so they execute in CI on every push (pytest --nbmake examples/) and reproduce without downloading a genome or model weights. Point them at a real
hg38 reference, a gnomAD database, and trained weights via the model zoo, and the call shapes are identical.
| Notebook | What it demonstrates |
|---|---|
01_clinvar_to_design |
The canonical journey: a variant → ranked prime-editing design across all four axes. |
02_population_offtarget |
The reference-bias case (rs114518452): a reference-only scan is blind to a population allele that creates a de-novo PAM; the population-aware engine nominates it and reports it ancestry-stratified. |
03_batch_vcf |
Cohort-scale design: resolve a batch of variants, design each, and reduce to one auditable summary with provenance. |
Full docs (concept guides, deployment, CLI reference, CRISPR-Bench, a
methods-preprint outline) build with mkdocs build --strict in CI.
The release pipeline is wired and tag-triggered (.github/workflows/release.yml) —
it stays inert until v0.1.0 is tagged, then it:
| Target | Mechanism |
|---|---|
| PyPI | python -m build → pypa/gh-action-pypi-publish via OIDC Trusted Publishing (no stored token) |
| Docker | multi-arch (linux/amd64 + linux/arm64) image pushed to GHCR with buildx |
| GitHub Release | sdist + wheel + CycloneDX SBOM attached, notes auto-generated |
| SBOM | cyclonedx-py over the resolved dependency closure, attached to the release |
| Zenodo DOI | minted on the tagged release (.zenodo.json) |
| conda | bioconda-style recipe (conda/meta.yaml) |
First public release is v0.1.0 (three chemistries end to end with the benchmark); v1.0.0 is reserved
for after external validation and the methods preprint. CITATION.cff ships for citation.
Every default is overridable; these are the spec-mandated starting points.
| Topic | Default | Notes |
|---|---|---|
| Reference / coordinates | hg38, 0-based half-open | T2T-CHM13 auto-recommended for ambiguous loci; mm39 for mouse |
| Strand | always explicit | no implicit "default strand"; spacers stored 5'→3' |
| SpCas9 PAM | NGG (primary), NAG low-stringency |
NG / SpRY opt-in when no NGG is actionable |
| Off-target search | ≤ 4 mismatches, ≤ 1 DNA + ≤ 1 RNA bulge | report CFD ≥ 0.20 or MIT ≥ 0.10 |
| Population inclusion | MAF ≥ 0.001, all populations | de-novo PAM & seed-mismatch changes always evaluated |
| Base-editing window | protospacer positions 4–8 | ABE8e (A→G), CBE4max / evoCDA1 (C→T); bystanders always reported |
| Prime editing | PE5max + epegRNA (tevopreQ1) | PBS 8–17 nt, RTT 7–34 nt; PE3b nicking guide when seed-disrupting |
| Uncertainty | 80% predictive interval | deep ensemble (N=5) + isotonic calibration |
| Seed | 20240501 |
threaded through every stochastic step, recorded in provenance |
alleleforge/
├── pyproject.toml # hatchling build, deps, ruff/mypy/pytest config
├── SPEC.md # the authoritative, phase-by-phase build contract
├── rust/ # PyO3 crate: aforge_native (BWT, k-mer, haplotype)
├── src/alleleforge/
│ ├── config.py # typed Settings (pydantic-settings), defaults, paths
│ ├── cache.py # R4: content-addressed cross-run disk cache (embeddings · off-target)
│ ├── _native.py # optional Rust bridge
│ ├── types/ # Phase 1: core domain vocabulary
│ ├── genome/ # Phase 2: reference access, FM-index, liftover
│ ├── data/ # Phase 3: registry, ClinVar, gnomAD, 1000G/HGDP, dbSNP, annotations
│ ├── variant/ # Phase 4: resolver, HGVS adapter, consequence
│ ├── offtarget/ # Phase 5: population/haplotype-aware off-target
│ ├── model_zoo/ # Phase 6: license-gated model cards + checkpoints
│ ├── scoring/ # Phase 6: embeddings, uncertainty, Scorer (this release)
│ ├── enumerate/ # Phases 7–9: SpCas9 guide · base-editor window · pegRNA enumeration
│ ├── design/ # Phases 7–10: nuclease · base · prime verticals + designer (routing · ranking) + cohort (R4 batch)
│ ├── report/ # Phase 11: oligos · report builder · JSON/TSV/Parquet · HTML · PDF
│ ├── cli/ # Phase 12: the aforge Typer CLI (resolve · design · batch · offtarget · data · bench)
│ ├── web/ # Phase 13: FastAPI api/ + served frontend/ (variant-first journey)
│ ├── benchmark/ # Phase 14: CRISPR-Bench — tasks · datasets · frozen splits · runner · leaderboard · calibration (R5)
│ ├── viz/ # R5: dependency-free SVG figure renderer (reference bias · coverage · ECE · gap)
│ └── ...
├── Makefile # local mirror of the CI gate (make ci · reproduce · figures · native)
├── tests/ # mirrors src/; pytest + hypothesis
├── examples/ # Phase 15: runnable notebooks (executed in CI via nbmake)
├── scripts/ # schema export · benchmark-fixture generator · reproduce (R0) · native_speedup · calibration_study · figures (R5)
├── conda/ # Phase 15: bioconda-style recipe
├── docs/ # mkdocs-material site (concepts · deployment · reference · paper · assets/figures)
└── .github/ # workflows: ci.yml (lint·type·test·docs·examples·rust·security·reproduce) · release.yml · dependabot.yml
pip install -e ".[dev]"
ruff check src tests scripts # lint + import order + docstrings
ruff format --check src tests scripts # formatting
mypy --strict src/alleleforge # strict type-check
pytest # tests + ≥85% coverage gate on core
pytest --nbmake examples/ --no-cov # execute the example notebooks
cd rust && cargo test && maturin develop # native crateThe library is fully typed and ships a PEP 561 py.typed marker, so mypy/pyright see its types
when you depend on it. A Makefile mirrors the gate so make ci reproduces it locally
(make lint type test docs reproduce; make figures for the docs figures, make native for the crate).
CI (GitHub Actions) runs lint, type-check (mypy --strict), tests (Python 3.11 + 3.12 on Linux & macOS),
a strict docs build, notebook execution, the Rust crate (cargo fmt · clippy · maturin build plus a
native↔Python FM-index parity run), a supply-chain audit (pip-audit + cargo audit), and a
reproducibility audit (scripts/reproduce.py re-derives the canonical run from config + seed and
diffs it against a committed golden) on every push and PR. See .github/workflows/ci.yml;
releases are cut on v* tags by .github/workflows/release.yml and emit
a CycloneDX SBOM. Dependabot tracks pip, cargo, and github-actions. The native
Rust crate builds locally with maturin (cd rust && maturin develop); the library runs in pure-Python
mode without it.
Contributions are welcome — please read CONTRIBUTING.md and the
Contributor Covenant 2.1 code of conduct.
tests/test_acceptance.py encodes the v0.1.0 release contract — the
specification's "definition of done" — as six end-to-end tests that run on every push:
| Release criterion | Proven by |
|---|---|
| A ClinVar accession flows end to end to a complete, provenance-stamped menu | test_clinvar_accession_to_complete_menu |
| The unified entry point reaches every chemistry (base · prime · nuclease) | test_every_chemistry_reachable_through_one_entry_point |
| A run is reproducible from config + seed (identical serialized menu) | test_run_is_reproducible_from_seed |
The reference-bias / rs114518452 off-target case is reproduced |
test_reference_bias_case_reproduced |
| Prime editing unifies all four axes | test_prime_unifies_all_four_axes |
| CRISPR-Bench publishes the Cas9-/PE-efficiency + off-target tasks with calibration & a leaderboard | test_crispr_bench_publishes_required_tasks |
- Research use only. AlleleForge produces hypotheses and rankings, not medical advice or clinical decisions. Every generated report repeats this.
- Off-target predictions require experimental validation. Computational nomination narrows the search; it does not replace GUIDE-seq / CHANGE-seq / amplicon confirmation.
- No telemetry, no phone-home. All computation runs locally or on user-controlled infrastructure. User sequences are never transmitted externally.
- Honest uncertainty over false confidence. Where models are out of distribution (e.g., prime-editing efficiency outside PRIDICT's HEK293T / K562 training context), AlleleForge flags it rather than hiding it.
- Dual-use awareness. This is a design and safety-analysis tool for legitimate therapeutic and basic research. It contains no wet-lab protocols or synthesis instructions.
AlleleForge is released under the MIT License — all code, schemas, benchmark, and any first-party model weights. It is fully open source and free to use, modify, and redistribute.
Each wrapped third-party tool or model retains its own upstream license, recorded in its model/tool card; the registry refuses to bundle any component whose license is incompatible with redistribution and fetches it at runtime with the user's consent instead.
If you use AlleleForge, please cite it via CITATION.cff. A Zenodo DOI is minted on the first
tagged release. The methods are written up in the draft preprint at
docs/paper/preprint.md (the posted version, with the real-data validation
numbers, follows the v1.0 release).