Skip to content

johnchen93/AmpliPy

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

25 Commits
 
 
 
 
 
 
 
 
 
 

Repository files navigation

AmpliPy

by John Chen

Overview

AmpliPy is a Python implementation of the primer binding and PCR analysis methods of Amplify 4 (https://github.com/wrengels/Amplify4). Given one or more primers and a DNA template, the program conducts a search for possible binding sites for each primer to the template, then tests the binding sites for formation of amplicons. AmpliPy does not implement the primer Tm or dimerization calculations features from Amplify 4. The PCR products are simply a list of possibilities given a set of primer binding sites. AmpliPy does not conduct actual PCR simulations.

The calculation of primer binding follows the primability and stability measures stated in the Amplify 4 help menu. In simple terms, the method checks how well the 3’ end of a primer matches any potential binding sites in the template. AmpliPy’s calculations tend to be a bit higher than Amplify 4’s numbers, possibly due to differences in rounding between the two implementations.

A javascript implementation is also accessible as a webtool here.

A PDF version of this README is available here.

Usage

Installation

AmpliPy requires an installation of Python 3.6 or higher. No other installation steps are required.

Data preparation

AmpliPy takes two input files, one specifying the primers to be analyzed and another that specifies DNA template for the PCR. The DNA template is simply a plain text file with just DNA (no headers or annotations). The primer file follows the format of Amplify 4, with primer sequences in the first column and the primer names in the second column. See the example template and primer files for more information.

Running AmpliPy from the command line

To use AmpliPy from the command line, simply run the ‘amplipy.py’ file using Python and supply the template file and the primer file as the first two arguments. Then, specify the primers to analyze by specifying a list (separated by spaces) of primer names (-n) or primer list positions (-p, numbering starts from 1).

For example, these two commands are equivalent.

python   amplipy.py   example_template.txt   example_primers.txt   -p   1   3
python   amplipy.py   example_template.txt   example_primers.txt   -n   TEM1-fwd  B1

By default, the template DNA is treated as linear. To specify a circular template, use the ‘-c’ option.

python   amplipy.py   example_template.txt   example_primers.txt   -p   1   3   -c

To send the output to a file instead of the command line, specify a file with the ‘-o’ option.

python   amplipy.py   example_template.txt   example_primers.txt   -p   1   3   -c   -o test_result.txt

Running from another Python script

To conduct the analysis from another script, import the ‘MakePrimer’ and ‘PCR’ functions from AmpliPy. See ‘import_example.py’ for a full example.

from amplipy import Primer, Template, PCR_Manager, Visuals

# define the template
template_seq = "TTAAGGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGANNCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTNNAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGACTAGTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTTAACAAAATTCACGCCCCGCCCTGCCACTCATCGCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCACAAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATAGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGCCATACGTAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATGCGAAACGATCCTCATCCTGTCTCTTGATCAGAGCTTGATCCCCTGCGCCATCAGATCCTTGGCGGCGAGAAAGCCATCCAGTTTACTTTGCAGGGCTTCCCAACCTTACCAGAGGGCGCCCCAGCTGGCAATTCCGGTGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGCCCATGGGATTCAAACTTTTGAGTAAGTTATTGGTCTATTTGACCGCGTCTATCATGGCTATTGCGAGCCCGCTCGCTTTTTCCGTAGATTCTAGCGGAGAATATCCGACAGTCAGCGAAATTCCGGTCGGGGAGGTCCGGCTTTACCAGATTGCCGATGGTGTTTGGTCGCATATCGCAACGCAGTCGTTTGATGGCGCAGTCTACCCGTCCAATGGTCTCATTGTCCGTGATGGTGATGAGTTGCTTTTGATTGATACAGCGTGGGGTGCGAAAAACACAGCGGCACTTCTCGCGGAGATTGAGAAGCAAATTGGACTTCCTGTAACGCGTGCAGTCTCCACGCACTTTCATGACGACCGCGTCGGCGGCGTTGATGTCCTTCGGGCGGCTGGGGTGGCAACGTACGCATCACCGTCGACACGCCGGCTAGCCGAGGTAGAGGGGAACGAGATTCCCACGCACTCTCTTGAAGGACTTTCATCGAGCGGGGACGCAGTGCGCTTCGGTCCAGTAGAACTCTTCTATCCTGGTGCTGCGCATTCGACCGACAACTTAATTGTGTACGTCCCGTCTGCGAGTGTGCTCTATGGTGGTTGTGCGATTTATGAGTTGTCACGCACGTCTGCGGGGAACGTGGCCGATGCCGATCTGGCTGAATGGCCCACCTCCATTGAGCGGATTCAACAACACTACCCGGAAGCACAGTTCGTCATTCCGGGGCACGGCCTGCCGGGCGGTCTTGACTTGCTCAAGCACACAACGAATGTTGTAAAAGCGCACACAAATCGCTCAGTCGTTGAGTAACTCGAGAAGCTTGTCACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTC"
template = Template(template_seq, is_circular=True)

# define primers
primer1 = Primer("TTCAAATATGTATCCGCTCATGAGACAAT", "TEM1-fwd")
primer2 = Primer("CCTTTTGCTGGCCTTTTGCTCC", "B1")


# to check just for binding sites
primer1_binding_sites = PCR_Manager.test_binding_on_template(primer1, template)
primer2_binding_sites = PCR_Manager.test_binding_on_template(primer2, template)

# show the parameters available in the data output
print(primer1_binding_sites)
print(primer1_binding_sites['fwd'][0]) # each primer is in a BindingResult dataclass
# use the Visuals class to print formatted binding sites
Visuals.print_primer_sites(primer1_binding_sites)

# to check for potential products when given a list of all binding sites
pdt_list = PCR_Manager.predict_products([primer1_binding_sites, primer2_binding_sites])
for pdt in pdt_list:
    print(pdt.visualization())


# To conduct the whole process and print the results in one command
PCR_Manager.PCR( [primer1, primer2], template, show_DNA=True, show_pdt=True )

Primer() takes a DNA sequence and optionally a label to create a primer object. Similarly, Template() takes a sequence and creates a template, with an optional ‘is_circular’ parameter; templates are treated as linear by default.

Lists of one or more Primer objects can then be fed to the PCR_Manager. test_binding_on_template() function as the first argument, followed by the template. The output of PCR_Manager. test_binding_on_template() is a dictionary of potential forward (key = ‘fwd’) and reverse (key = ‘rev’) primer binding sites, each represented by a ‘BindingResult’ object. The binding site dictionary can be visualized using the Visuals.print_primer_sites() function. Each BindingResult contains information, including the position of the 3’ end (pos), the primer binding stats (primability, stability and quality), whether the direction of binding is reversed relative to the template (reverse).

A list of binding site dictionaries can be supplied to the PCR_Manager.predict_products() function to check for potential PCR products. The sites need to share the same template. Each product is represented by a PCR_Product object that includes their sequence (under the key ‘seq’) and the primer binding sites that generated the product (f_site and r_site).

Use the PCR_Manager.PCR() function to simultaneously conduct a search of potential primer binding sites on a template and list possible products. The output is directly printed to the terminal.

About

Python implementation of the Amplify 4 PCR program.

Resources

License

Stars

0 stars

Watchers

1 watching

Forks

Releases

No releases published

Packages

 
 
 

Contributors

Languages