Skip to content

michael-weinstein/dsNickFury

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

24 Commits
 
 
 
 
 
 
 
 

Repository files navigation

HOW TO USE dsNickFury:


dsNickFury vs. dsNickFury-Server

Version 1.1 and later: Server and original versions have been merged into a single program. Default values are still the same and are set depending upon the type of run requested. If you are running this program on a single system or server, you will need to pass --standAlone as a commmand line argument. If you are running this program on a cluster and submitting jobs via qsub command, you will need to pass --cluster on the command line. One of these system modes must be passed on the command line.

Version 1.0 and earlier: The two programs are very similar, with the only differences being that Server is designed for running on a single machine or web server while the original was designed to run on a large cluster system designed to take qsub commands. After reconciling any differences between the two versions, the only differences between them are how they execute parallel jobs and the preset limits on parallel job count and maximum targets in a selection job. Because of this, there is a very good chance that the next version I make will be a unification between these two, with a command line option deciding between single-system and cluster.

Setting up the script

In order to run, you MUST enter either the absolute path (preferred) or the shortcut you use (carries potential risks of errors) to access your python3 interpreter. Absolute paths should always work so long as they are the correct path for a python3 interpreter; passing a shortcut sometimes works. You can do this by looking for where the global variable pythonInterpreterAbsolutePath is set (this should be just after the license information, or just grep for the second time it appears). Remember to enter the path between the quotes and remove any spaces at the beginning or end. You can also set some limits on job size while you're editing this portion of the program. You can set a limit for how many potential targets can be allowed during a single selection mode job and how many parallel jobs can be going at one time for one of these jobs (this can be very important if you are running on a single server with limited resources or a cluster that limits how many items you can have in the job queue).

Requirements:

This program requires Python3 and the basic Python library (urllib was likely included with your installation). To run with the --cluster-- option set, you will (obviously) need to be on a cluster system with a scheduler that can take qsub commands. If you have a cluster that requres different commands to schedule jobs, please contact me and we can look into making this compatible.

Setting different modes:

There are 5 possible modes for this program to run in:

selection will look through either a list of sequences, or a sequence passed on the command line, or a FASTA sequence file to find potential targets and rank them.

index will search a genome and save any potential targets based on the user-defined guide length and PAM sequence.

search will look through an indexed genome for anything matching the user-defined target site within the user-defined mismatch tolerance.

worker is a search worker process for parallelizing the search to speed it up. Users generally won't set this unless troubleshooting.

FASTAworker is a worker process for indexing a genome. Users will generally not set this either, unless troubleshooting.

The mode will always be passed under the -m command line argument and is always required for a run.

How to run a job:

Defining your Cas9/Crispr-type system: Every mode requires the user to define what their system looks like. This will be done by passing either a specific sequence (for searches) or a generic sequence (for indexing and site selection). A generic sequence with a 20bp guide RNA and a PAM sequence of NGCG can be formatted as NNNNNNNNNNNNNNNNNNN_NGCG or can be written as 20_NGCG any guide length and PAM sequence combination can be indexed and then searched, although you will have to run the program in clobber mode (argument -9) to use one with a combined length below 16 bases (such a system would likely be of limited use, and you would need to take care to avoid creating memory errors due to too many matches during a search). PAM sequences can, and often will, have at least one degenerate nucleotide in them. The guide and PAM must be separated with an underscore. For indexing a system that can take multiple lengths of gRNA, index the longest possible version (and even a little extra), as that same indexed genome can be used for shorter versions as well. A specific sequence will be required for search jobs. That is defined the same way, except that the N's in the gRNA portion will be replaced by your actual sequence. The sequence will be passed under the -s command line argument.

Selecting your genome: Every job will require passing a genome argument. This argument will be passed as -g [GENOME]. For indexing, this will define the name of the genome (such as HG38). Genome names can be arbitrary, but should be informative and easy to remember, as that name will be used to select it for searching in the future.

Selecting a species: You will need to choose a species for your genome when indexing it. In order to get back information regarding genes associated with a target or mismatch site, please be sure that the species name given is the same as is used by the Ensembl servers. The indexer will warn you if you are selecting a species not listed in the ensembl databases and you will have to run with command line option -9. You will also need to use this option if you wish to index a genome with the same genome name but a different species identifier as a previously-indexed genome (you probably don't want to have this situation).

Site selection: This requires the user to define a target sequence, which can either be in a file (passed as --targetFasta [filename] or directly as --targetSequence [sequence]). Alternatively, the user can pass a list of already-determined target sites in a file as --targetList [filename] with one potential target site per line. This also requires the user to define their system as described above. The genome name is also required and can be passed under the -g argument. Optional arguments include mismatch tolerance (-t, default value of 3) and parallel jobs per search (-p, default of 10). Azimuth analysis can be skipped entirely by passing --skipAzimuth.

SAMPLE COMMANDLINE:

dsNickFuryX.X.py -m selection -s 20_NGG -g hg38 --targetFasta file.fa

Mismatch search: This requires the user to define their system, as described above (passed as the -s argument and using a specific sequence instead of generic). This also requires the user to define which genome they wish to search (passed as the -g argument). The program will search the folder of indexed genomes for a suitable one (having a compatible PAM sequence, and a guide RNA of equal or greater length). Optional arguments include the number of parallel jobs for the search (passed as -p with a default of 20) and mismatch tolerance (passed as -t with a default of 3).

SAMPLE COMMAND LINE:

dsNickFuryX.X.py -m search -s GATTACAGATTACAGAATTC_TGG -g hg38

Genome index: This will be done for every genome/system combination unless a suitable indexed genome already exists (one with the same PAM and longer gRNA size). The indexing will gather information about target frequency between contains and will also generate files listing these target sequences. This speeds up the search process tremendously. The user will have to define a generic target sequence for their system (as described above, passed under the -s argument as always). They will also need to state which species the genome is from (passed as --species). The stated species should use the same name as is listed in ensembl's website. A FASTA formatted sequence is required for indexing. This is passed under the -f argument. The FASTA file needs to have been indexed (a companion .fai file generated) by SAMtools or another equivalent FASTA indexer. If there are specific chromosomes/contigs in the genome you want to skip, simply delete their lines from the .fai file and they will be ignored by the indexer. Optional arguments include --ordered, which will generate only a single parallel job per contig. Users can set the chunk size for parallel chromosome indexing. With more nodes available for computing or a smaller genome, a smaller chunksize can decrease the time required before indexing is complete. This can be passed as --chunkSize INT, with INT representing an integer value. If a value less than 100 is passed, it will be assumed to mean megabases. To avoid causing conflicts with your cluster, the program may automatically increase your chunk size to avoid creating too many parallel jobs at once, depending on the parallel job limit you set in the program's global variables. In order to ignore/overwrite an existing suitable genome or use a species name not listed on ensembl, run the indexing with command option -9 or --clobber.

SAMPLE COMMAND LINE:

dsNickFuryX.X.py -m index -f hg38.fa -g hg38 --species Human -s NNNNNNNNNNNNNNNNNNNN_NGG

Azimuth analysis:

In order to run an analysis using Azimuth, you will need an API key stored in the same directory as this program in file azimuth.apikey. If you require a key, please contact the people responsible for maintaining the Azimuth server. If you are not using the standard NGG Cas9/Crispr system with a 20 base guide, this program will try to force your sites to fit into their model. Because of this, the predictions may not be accurate.

Thank you for allowing me to assist in your efforts,

Michael Weinstein

About

This program is designed to look for potential off-target hits by any Cas9-Crispr type of system, including ones from alternate species with different PAM sites. This program requires python3 and a cluster system wtih a job queue such as openSGE or similar as well as an active connection to the Internet. The package dependencies were kept intentio…

Resources

Stars

Watchers

Forks

Releases

Packages

Contributors

Languages