Skip to content

Repository files navigation

NGS-Analysis-in-R/Bioconducot

Sequence Analysis Tutorial in R and Bioconductor.

Introduction

Here I tried to learn how to Analyse NGS in R without using Linux Terminal.

Why NGS Analysis with R/Bioconductor?

  • Hundreds of reusable NGS packages are available
  • Invent new things rather than reinventing existing ones
  • Many NGS methods require advanced statistical methods
  • Many NGS applications share similar analysis needs. Most of them have existing solutions.
  • Access to advanced and reproducible genome graphics

R Base

Some basic string handling utilities. Wide spectrum of numeric data analysis tools.

Bioconductor

Bioconductor packages provide much more sophisticated string handling utilities for sequence analysis (Lawrence et al. 2013; Huber et al. 2015).

Bioconductor Package Requirements

To install bioconductor packages, execute the following lines in the R console. Please also make sure that you have a recent R version installed on your system. R versions 3.3.x or higher are recommended.

source("https://bioconductor.org/biocLite.R")

if (!requireNamespace("BiocManager", quietly = TRUE))

install.packages("BiocManager") BiocManager::install(c("Biostrings", "GenomicRanges", "rtracklayer", "systemPipeR", "seqLogo", "ShortRead"))

Last login: Tue Apr 29 09:59:51 on ttys000 (base) mhasan@MacBook-Pro ~ % ssh mehadi@gryffindor.nri.bcm.edu ssh: connect to host gryffindor.nri.bcm.edu port 22: Undefined error: 0 (base) mhasan@MacBook-Pro ~ % ssh mehadih@skyriver.nri.bcm.edu mehadih@skyriver.nri.bcm.edu's password: Welcome to Ubuntu 22.04.3 LTS (GNU/Linux 6.5.0-15-generic x86_64)

Expanded Security Maintenance for Applications is not enabled.

274 updates can be applied immediately. 165 of these updates are standard security updates. To see these additional updates run: apt list --upgradable

18 additional security updates can be applied with ESM Apps. Learn more about enabling ESM Apps service at https://ubuntu.com/esm

The list of available updates is more than a week old. To check for new updates run: sudo apt update

Welcome to Bright Cluster Manager 9.2

                                    Based on Ubuntu Jammy Jellyfish 22.04
                                                Cluster Manager ID: #00000

Use the following commands to adjust your environment:

'module avail' - show available modules
'module add ' - adds a module to your environment for this session 'module initadd ' - configure module to be loaded at every login (Note: initadd is available only for Tcl modules)


Last login: Fri Apr 25 20:24:55 2025 from 10.70.15.96 (base) mehadih@leia1:$ (base) mehadih@leia1:$ cd (base) mehadih@leia1:$ ls bioinformatics miniconda3 my_cache_dir todolist work_bcm (base) mehadih@leia1:$ cd bioinformatics/ (base) mehadih@leia1:/bioinformatics$ ls collab liuzlab ngsalex tools (base) mehadih@leia1:/bioinformatics$ cd .. (base) mehadih@leia1:$ cd work_bcm/ (base) mehadih@leia1:/work_bcm$ ls mhasan_projects (base) mehadih@leia1:/work_bcm$ cd mhasan_projects/ (base) mehadih@leia1:/work_bcm/mhasan_projects$ ls dataset_2024 project2024 project2025 scripts_mhasan (base) mehadih@leia1:/work_bcm/mhasan_projects$ pwd /home/mehadih/work_bcm/mhasan_projects (base) mehadih@leia1:/work_bcm/mhasan_projects$

(base) mehadih@leia1:/work_bcm/mhasan_projects$ ls dataset_2024 project2024 project2025 scripts_mhasan (base) mehadih@leia1:/work_bcm/mhasan_projects$ pwd /home/mehadih/work_bcm/mhasan_projects (base) mehadih@leia1:/work_bcm/mhasan_projects$ cd (base) mehadih@leia1:$ pwd /home/mehadih (base) mehadih@leia1:$ cd /home/mehadih/work_bcm/mhasan_projects (base) mehadih@leia1:/work_bcm/mhasan_projects$ mv scripts_mhasan/ /home/mehadih (base) mehadih@leia1:/work_bcm/mhasan_projects$ cd (base) mehadih@leia1:$ ls bioinformatics miniconda3 my_cache_dir scripts_mhasan todolist work_bcm (base) mehadih@leia1:$ mv scripts_mhasan/ mehadi (base) mehadih@leia1:$

(base) mehadih@leia1:$ ls bioinformatics mehadi miniconda3 my_cache_dir todolist work_bcm (base) mehadih@leia1:$ cd mehadi/ (base) mehadih@leia1:/mehadi$ ks ks: command not found (base) mehadih@leia1:/mehadi$ ls git_command scripts-ncbi-geo star_read_merge motif_project scripts_nextflow star_scripts_hamin scripts-go-kegg-ora scripts_salmon star_scripts_yanli scripts_gsva scripts_variant_calling vim_command (base) mehadih@leia1:~/mehadi$

(base) mehadih@leia1:/mehadi$ cd scripts_gsva/ (base) mehadih@leia1:/mehadi/scripts_gsva$ ls data plots results scripts (base) mehadih@leia1:/mehadi/scripts_gsva$ cd scripts/ (base) mehadih@leia1:/mehadi/scripts_gsva/scripts$ ls gsva_esme.Rmd gsva_trial.Rmd pathway-analysis_rnaseq_03_gsva.Rmd (base) mehadih@leia1:~/mehadi/scripts_gsva/scripts$ vim gsva_esme.Rmd

coldata2F = xp_design |> filter((genotype == "WT" | genotype == "Atxn1L_KO") & (gender=="F"))

coldata2F$sampleID


# *comparison-3: WT-Cic_KO* Mutant vs WT
```{r}
# Male
coldata3M = xp_design |>
  filter((genotype == "WT" | genotype == "Cic_KO")
         & (gender=="M"))

coldata3M$sampleID


# Female
coldata3F = xp_design |>
  filter((genotype == "WT" | genotype == "Cic_KO")
         & (gender=="F"))

coldata3F$sampleID
                                                              174,1         25%



## Bioconductor packages use in NGS:

* Biostrings: general sequence analysis environment
* ShortRead: pipeline for short read data
* IRanges: low-level infrastructure for range data
* GenomicRanges: high-level infrastructure for range data
* GenomicFeatures: managing transcript centric annotations
* GenomicAlignments: handling short genomic alignments
* systemPipeR: NGS workflow and report generation environment
* Rsamtools: interface to samtools, bcftools and tabix
* BSgenome: genome annotation data
* biomaRt: interface to BioMart annotations
* rtracklayer: Annotation imports, interface to online genome browsers
* HelloRanges: Bedtools semantics in Bioc’s Ranges infrastructure

## Sequences in Bioconductor
XString for single sequence :

* DNAString: for DNA
* RNAString: for RNA
* AAString: for amino acid
* BString: for any string

XStringSet for many sequences:

* DNAStringSet: for DNA
* RNAStringSet: for RNA
* AAStringSet: for amino acid
* BStringSet: for any string

QualityScaleXStringSet for sequences with quality data:

* QualityScaledDNAStringSet: for DNA
* QualityScaledRNAStringSet: for RNA
* QualityScaledAAStringSet: for amino acid
* QualityScaledBStringSet: for any string

## Sequence Import and Export
Download the following sequences to your current working directory and then import them into R:

https://ftp.ncbi.nlm.nih.gov/genomes/archive/old_genbank/Bacteria/Halobacterium_sp_uid217/AE004437.ffn


# NGS Sequences
Sequence and Quality Data: FASTQ Format

Four lines per sequence:

ID
Sequence
ID
Base call qualities (Phred scores) as ASCII characters

The following gives an example of 3 Illumina reads in a FASTQ file. 

1. @SRR038845.3 HWI-EAS038:6:1:0:1938 length=36
2. CAACGAGTTCACACCTTGGCCGACAGGCCCGGGTAA
3. +SRR038845.3 HWI-EAS038:6:1:0:1938 length=36
4. BA@7>B=>:>>7@7@>>9=BAA?;>52;>:9=8.=A

## Sequence and Quality Data: QualityScaleXStringSet
Phred quality scores are integers from 0-50 that are stored as ASCII characters after adding 33. The basic R functions rawToChar and charToRaw can be used to interconvert among their representations.

## Range Operations
Important Data Objects for Range Operations.
* IRanges: stores range data only (IRanges library)
* GRanges: stores ranges and annotations (GenomicRanges library)
* GRangesList: list version of GRanges container (GenomicRanges library)

Last login: Tue Apr 29 09:59:51 on ttys000
(base) mhasan@MacBook-Pro ~ % ssh mehadi@gryffindor.nri.bcm.edu 
ssh: connect to host gryffindor.nri.bcm.edu port 22: Undefined error: 0
(base) mhasan@MacBook-Pro ~ % ssh mehadih@skyriver.nri.bcm.edu 
mehadih@skyriver.nri.bcm.edu's password: 
Welcome to Ubuntu 22.04.3 LTS (GNU/Linux 6.5.0-15-generic x86_64)

 * Documentation:  https://help.ubuntu.com
 * Management:     https://landscape.canonical.com
 * Support:        https://ubuntu.com/pro

Expanded Security Maintenance for Applications is not enabled.

274 updates can be applied immediately.
165 of these updates are standard security updates.
To see these additional updates run: apt list --upgradable

18 additional security updates can be applied with ESM Apps.
Learn more about enabling ESM Apps service at https://ubuntu.com/esm


The list of available updates is more than a week old.
To check for new updates run: sudo apt update

Welcome to Bright Cluster Manager 9.2 
 
                                        Based on Ubuntu Jammy Jellyfish 22.04
                                                    Cluster Manager ID: #00000

Use the following commands to adjust your environment:                        
 
'module avail'            - show available modules                            
'module add <module>'     - adds a module to your environment for this session
'module initadd <module>' - configure module to be loaded at every login
                            (Note: initadd is available only for Tcl modules)
 
-------------------------------------------------------------------------------
Last login: Fri Apr 25 20:24:55 2025 from 10.70.15.96
(base) mehadih@leia1:~$ 
(base) mehadih@leia1:~$ cd
(base) mehadih@leia1:~$ ls
bioinformatics  miniconda3  my_cache_dir  todolist  work_bcm
(base) mehadih@leia1:~$ cd bioinformatics/
(base) mehadih@leia1:~/bioinformatics$ ls
collab  liuzlab  ngsalex  tools
(base) mehadih@leia1:~/bioinformatics$ cd ..
(base) mehadih@leia1:~$ cd  work_bcm/
(base) mehadih@leia1:~/work_bcm$ ls
mhasan_projects
(base) mehadih@leia1:~/work_bcm$ cd mhasan_projects/
(base) mehadih@leia1:~/work_bcm/mhasan_projects$ ls
dataset_2024  project2024  project2025  scripts_mhasan
(base) mehadih@leia1:~/work_bcm/mhasan_projects$ pwd
/home/mehadih/work_bcm/mhasan_projects
(base) mehadih@leia1:~/work_bcm/mhasan_projects$ 








(base) mehadih@leia1:~/work_bcm/mhasan_projects$ ls
dataset_2024  project2024  project2025  scripts_mhasan
(base) mehadih@leia1:~/work_bcm/mhasan_projects$ pwd
/home/mehadih/work_bcm/mhasan_projects
(base) mehadih@leia1:~/work_bcm/mhasan_projects$ cd
(base) mehadih@leia1:~$ pwd
/home/mehadih
(base) mehadih@leia1:~$ cd /home/mehadih/work_bcm/mhasan_projects
(base) mehadih@leia1:~/work_bcm/mhasan_projects$ mv scripts_mhasan/ /home/mehadih
(base) mehadih@leia1:~/work_bcm/mhasan_projects$ cd
(base) mehadih@leia1:~$ ls
bioinformatics  miniconda3  my_cache_dir  scripts_mhasan  todolist  work_bcm
(base) mehadih@leia1:~$ mv scripts_mhasan/ mehadi
(base) mehadih@leia1:~$ 









(base) mehadih@leia1:~$ ls
bioinformatics  mehadi  miniconda3  my_cache_dir  todolist  work_bcm
(base) mehadih@leia1:~$ cd mehadi/
(base) mehadih@leia1:~/mehadi$ ks
ks: command not found
(base) mehadih@leia1:~/mehadi$ ls
git_command          scripts-ncbi-geo         star_read_merge
motif_project        scripts_nextflow         star_scripts_hamin
scripts-go-kegg-ora  scripts_salmon           star_scripts_yanli
scripts_gsva         scripts_variant_calling  vim_command
(base) mehadih@leia1:~/mehadi$ 













(base) mehadih@leia1:~/mehadi$ cd scripts_gsva/
(base) mehadih@leia1:~/mehadi/scripts_gsva$ ls
data  plots  results  scripts
(base) mehadih@leia1:~/mehadi/scripts_gsva$ cd scripts/
(base) mehadih@leia1:~/mehadi/scripts_gsva/scripts$ ls
gsva_esme.Rmd  gsva_trial.Rmd  pathway-analysis_rnaseq_03_gsva.Rmd
(base) mehadih@leia1:~/mehadi/scripts_gsva/scripts$ vim gsva_esme.Rmd 
(base) mehadih@leia1:~/mehadi/scripts_gsva/scripts$ 
















(base) mehadih@leia1:~/mehadi/scripts_gsva/scripts$ ls
gsva_esme.Rmd  gsva_trial.Rmd  pathway-analysis_rnaseq_03_gsva.Rmd
(base) mehadih@leia1:~/mehadi/scripts_gsva/scripts$ vim pathway-analysis_rnaseq_03_gsva.Rmd 




















# Purpose of this analysis

This example is one of pathway analysis module set, we recommend looking at the [pathway analysis table below](#how-to-choose-a-pathway-analysis) to help you determine which pathway analysis method is best suited for your purposes.

In this example we will cover a method called Gene Set Variation Analysis (GSVA) to calculate gene set or pathway scores on a per-sample basis [@Hanzelmann2013].
GSVA transforms a gene by sample gene expression matrix into a gene set by sample pathway enrichment matrix [@Hanzelmann-github].
We'll make a heatmap of the enrichment matrix, but you can use the GSVA scores for a number of other downstream analyses such as differential expression analysis.

⬇️ [**Jump to the analysis code**](#analysis) ⬇️

### What is pathway analysis?

Pathway analysis refers to any one of many techniques that uses predetermined sets of genes that are related or coordinated in their expression in some way (e.g., participate in the same molecular process, are regulated by the same transcription factor) to interpret a high-throughput experiment.
"pathway-analysis_rnaseq_03_gsva.Rmd" 688L, 34262B            1,1           Top

About

NGS Analysis in R/Bioconductor.

Resources

Stars

0 stars

Watchers

1 watching

Forks

Releases

Packages

Contributors