Skip to content

phenotypic/Primer-Designer

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

30 Commits
 
 
 
 
 
 
 
 
 
 

Repository files navigation

Primer-Designer

This script will calculate the optimal PCR primers for a given gene.

The DNA sequence of the target gene is retrieved using the Ensembl REST API, overlapping sections between splice variants are calculated, then primer3 is used to find the best primer pairs.

Prerequisites

You must have python3 installed. You will need to install any other outstanding requirements:

Command Installation
primer3 Install via brew by running brew install primer3

Usage

Clone the repository:

git clone https://github.com/phenotypic/Primer-Designer.git

Change to the project directory:

cd Primer-Designer

Install dependencies:

pip3 install -r requirements.txt

Run the script:

python3 designer.py

Here are some flags you can add:

Flag Description
-s <species> Species: Define a species (script will prompt you otherwise)
-g <gene> Gene: Define a target gene (script will prompt you otherwise)
-p <file> Parameters: Define parameter file (script defaults to parameters.txt)
-t <directory> Thermals: Set a custom thermodynamic configuration path (script will use default otherwise)
-v Verbose: Activate verbose output

After running the script and selecting a target species and gene, the overlapping regions of any splice variants will be found.

Next, you will be asked if you want to adjust the default primer search parameters:

+-------+--------------------+---------+
| Index |     Parameter      |  Value  |
+-------+--------------------+---------+
|   1   |  Primer min size   |    20   |
|   2   |  Primer opt size   |    23   |
|   3   |  Primer max size   |    26   |
|   4   |   Primer min Tm    |    56   |
|   5   |   Primer opt Tm    |    60   |
|   6   |   Primer max Tm    |    64   |
|   7   | Product size range | 300-500 |
+-------+--------------------+---------+

Finally, the script will generate pairs of primers. Primer pair 1 is usually the most optimal:

Primer pair 1
---------------------
Gene name: wnt10a
Species: zebrafish
Product size: 458
Any compl   : 0.00
End compl   : 0.00
+-----------+--------+--------+--------+--------------+---------+---------------+-------------------------+
| Direction | Length |   Tm   |  GC%   | Self-binding | Hairpin | End Stability |         Sequence        |
+-----------+--------+--------+--------+--------------+---------+---------------+-------------------------+
|    Left   |   23   | 59.995 | 47.826 |     0.00     |   0.00  |     3.2800    | CCTCTTCTGTTCTTTGGCTTTGG |
|   Right   |   23   | 60.121 | 47.826 |     0.00     |   0.00  |     3.1800    | GACGGTTGAGCTTGATTCTGAAC |
+-----------+--------+--------+--------+--------------+---------+---------------+-------------------------+

Notes

  • If your target gene has lots of splice varaints (e.g. DARS2), it is possible that there will not be any overlapping sequences across all varaints. In this case, you should manually select the splice varaints which are most prevalent.
  • You can modify the default primer search parameters by modifying parameters.txt directly
  • The script has been thoroughly tested with these zebrafish genes:
    • wnt10a (direction: 1, variants: multiple)
    • lamb1a (direction: -1, variants: multiple)
    • slc7a5 (direction: -1, variants: single)

To-do

  • BLAST primer check
  • Allow command arguments for primer parameters
  • Allow input for left or right primer
  • Save info and sequence files locally for offline checks
  • Ensure individual primers are not found overlapping two exons (exlusively search pairs of primers)

About

Automated PCR primer designer

Resources

License

Stars

2 stars

Watchers

1 watching

Forks

Contributors

Languages