Folders and files
| Name | Name | Last commit date | ||
|---|---|---|---|---|
Repository files navigation
README
======
Table of Contents
-----------------
I. Introduction
II. Installation Instructions
III. Usage Instructions and Examples
IV. Funding and Acknowledgements
V. Contact
I. Introduction
---------------
Kmer-SSR is a software tool developed to find Simple Sequence Repeats (SSRs) in
a sequence (presumably of DNA or RNA). SSRs are sometimes referred to as Short
Tandem Repeats (STRs) or microsatellites. SSRs are genetic markers with several
interesting and meaningful biological implications. For example, SSRs can play
significant roles in genome alignment against a reference and species
identification.
Many software tools exist for this purpose, but vary widely in utility. Some
key features of our tool are as follows:
- Fast run time (linear, O(n), time complexity)
- Memory efficient (linear, O(n), space complexity)
- Finds all perfect repeats
- Simple command-line interface, convenient for scripting and when running
on High-Performance Computing (HPC) systems (note: no GUI provided)
- Easily parsed, tab-delimited output
- Runs on Linux (not Windows or Mac OS X)
See our paper in __journal__ for further information:
http://sub.domain.tld/path/to/resource
II. Installation Instructions
-----------------------------
To compile Kmer-SSR, simply type `make'. The binary will be in the `bin'
directory. Your compiler must support C++11.
To compile and install, type `make' followed by `make install'. The binary
will be in both the `bin' and `/usr/local/bin' directories (to change this,
change the `PREFIX' variable in `Makefile').
To uninstall, type `make clean'.
See `INSTALL' for further instructions.
III. Usage Instructions and Examples
-------------------------------------
Please run the software with the `--help' option for complete usage instructions
(i.e., type `kmer-ssr -h' or `kmer-ssr --help'). The format of the input and
output files is described below; followed by usage examples.
Input File Format:
Description:
The input file must be in Fasta format. The sequences may be on a single
line or multiple lines. The header and sequence lines must not contain
any leading or trailing whitespace. The header line must not contain any
tabs. The sequence lines must not contain whitespace between
nucleotides. Mixed-case nucleotides are acceptable; they will be
replaced with uppercase nucleotides for finding SSRs.
Good Example:
>sequence 1
AGCGTGTCGTGTACACGTGTACGTACGTACGATCGATGCTACGTAGCATCGATCGACGTATCGTATCGATC
CACGTGTACGTACGTACGATCGATGCTACGTAGCATCGATCGACGTATCGTATCGATCAGCGTGTCGTGTA
.
.
.
>sequence 2
cgtacgatcgatgctacgtagcatcgatcgacgtatcgtatcgatcagcgtgtcgtgtacacgtgtacgta
gatcgacgtatcgtatcgatcagcgtgtcgtgtacacgtgtacgtacgtacgatcgatgctacgtagcatc
.
.
.
>sequence 3
taTCgATCAGCGtGTCGTGTAcACGTGTACGTAcgtaCGAtCgATGCTACGTagcatCGATCGACGTATCG
cgtacgtacgATCGATGCTACGTaGCATCGaTCGaCGTAtCGTAtcgatcaGCGTGTCGTGTAcacgtgta
.
.
.
Output File Format:
Description:
The output file is tab-delimited. Each row is a separate record. By
default, if no SSRs are found in a fasta sequence, no output record
will be present in the output file for that fasta sequence. When SSRs
are found, one output record will be present in the output file for
each SSR in that sequence. Each column contains a separate piece of
information for the output record. The columns (in order) are:
Sequence_Name, SSR, Repeats, Position (zero-based)
Each of the columns are described below:
Sequence_Name: The entire header line from the fasta file (excluding the
leading `>' character) from which the SSR in the given
output record is found.
SSR: The repeating unit of an SSR. For example, `ACACAC' is
an SSR with a repeating unit of `AC'.
Repeats: The number of times the repeating unit of an SSR repeats.
For example, the repeating unit of `AC' from SSR `ACACAC'
repeats 3 times.
Position: The zero-based position in the original fasta sequence
where the SSR begins. For example, `ACACAC' begins at
position 2 in the sequence `TGACACACGT'.
As a simple illustration of the output file, consider the following
input file and its respective output file:
Input:
>seq 1
TGACACACGT
>seq 2
acgtg
tgtca
cagtc
Output (formatted here for readability):
Sequence_Name SSR Repeats Position (zero-based)
seq 1 AC 3 2
seq 2 GT 3 2
seq 2 CA 2 8
Usage Examples:
Basic Usage Examples:
Example 1:
kmer-ssr -i input.fasta -o output.tsv
Run Kmer-SSR on fasta sequences in `input.fasta' and write results to
`output.tsv'. This will use the default parameters; run the software
with `--help' to see the defaults and check if they meet your needs.
Example 2:
kmer-ssr -p 2-9 -r 3 -R 20 -i input.fasta -o output.tsv
Run Kmer-SSR on fasta sequences in `input.fasta' and write results to
`output.tsv'. Only SSRs meeting the parameters provided will be
included. The meaning of each option is as follows:
-p Search for SSRs with a period size of 2, 3, 4, 5, 6,
7, 8, or 9. As examples: `AAAAAA...' and
`ACGCAGTTGCACGCAGTTGC...' would not make the cutoff
because `A' is shorter than 2 nucleotides and
`ACGCAGTTGC' is longer than 9 nucleotides. However,
`ACACAC...' and `AATCCTGGTAATCCTGGT...' would be
included.
-r, -R The min (-r) and max (-R) times the repeating unit
repeats. As examples: `ACAC' and `ACACACACACACACACACACAC
ACACACACACACACACACAC' (21 `AC' units) would not make the
cutoff. However, `ACACAC' and `ACACACACACACACACACACACACAC
ACACACACACACAC' (20 `AC' units) would be included.
Example 3:
kmer-ssr -t 4 -i input.fasta -o output.tsv
Run Kmer-SSR on fasta sequences in `input.fasta' and write results to
`output.tsv'. Use 4 threads of execution, instead of the default 1.
Example 4:
kmer-ssr -p 2-9 -r 3 -R 20 -t 4 -i input.fasta -o output.tsv
Run Kmer-SSR on fasta sequences in `input.fasta' and write results to
`output.tsv'. This is a combination of examples 2 and 3.
Extended Example:
The data for this extended example can be found in the `examples'
directory. The input fasta file is `input.fasta'. The output files are
`output_default.tsv' and `output.tsv'. The data and example are
fictitious, but was modified from real sequences. The numbers used for
min/max sequence length or any other parameter may not be biologically
realistic; however, they do conceptually represent a realistic
situation.
input.fasta: Each fasta sequence is a contig generated from a de novo
assembly of whole exome sequencing reads. The file has 16
fasta sequences.
output*.tsv: The output files from running Kmer-SSR as shown below.
One could just run Kmer-SSR with the defaults:
kmer-ssr -i input.fasta -o output_default.tsv
However, the defaults may not be the best parameters for your data.
Below is a reasonable command to use with this example data. Each
alteration from the default is explained and justified based on the
data in this example.
kmer-ssr -l 70 -L 300 -p 2-9 -r 2 -t 4 -f -i input.fasta -o output.tsv
-l 70 Do not search for SSRs in fasta sequences less than 70 bps in
length. For sake of the example, we assume based on our reads
and the assembler's parameters and intricacies that the
resulting contigs should be equal to or longer than 70 bps.
Anything shorter would be erroneous and not worth searching for
SSRs.
-L 300 Do not search for SSRs in fasta sequences more than 300 bps in
length. For sake of the example, we assume based on our reads
and the assembler's parameters and intricacies that the
resulting contigs should be equal to or shorter than 300 bps.
Anything longer would be erroneous and not worth searching for
SSRs.
-m 2 Do not report SSRs where the base unit is less than 2 bps
in length. This decision must be made based on your research
question(s) and what you deem biologically interesting.
-M 9 Do not report SSRs where the base unit is more than 9 bps
in length. This decision must be made based on your research
question(s) and what you deem biologically interesting.
-r 2 Do not report SSRs where the base unit repeats less than 2
times. This decision must be made based on your research
question(s) and what you deem biologically interesting.
-t 4 Use 4 threads of execution instead of the default 1. This must
be based on the machine you run Kmer-SSR on. Obviously, it
doesn't make sense to run with 9 threads on an 8 thread
machine.
-f Output the full sequence from the fasta file from which an SSR
in a particular output record was found. This may be desirable
if your downstream analysis requires knowing the full sequence
from which the SSR was found. This option is intended to ease
downstream analysis by removing the requirement to parse the
original fasta file and the output file simultaneously. If you
do not need this, do not use this option as it will radically
increase the size of the output file.
If you inspect these two output files, you'll observe 12 output records
in `output_default.tsv' and 7 output records in `output.tsv'. Using the
custom parameters removed 6 output records; each were theoretically
erroneous results (the SSRs really were there in the fasta sequence,
but the fasta sequence wasn't valid). 1 additional output record was
added by using the custom parameters because the fasta sequence was
below the minimum length for processing under the default parameters.
IV. Funding and Acknowledgements
-------------------------------
Funding for the research and production of this software was provided by
startup funds to Dr. Perry Ridge.
V. Contact
-----------
For questions, comments, concerns, feature requests, suggestions, etc., please
contact:
Pery Ridge, Ph.D. -- perry.ridge@byu.edu
Note: For usage questions, please consult section `III. Usage Instructions and
Examples' first.