Skip to content
 
 

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

33 Commits
 
 
 
 
 
 
 
 

Repository files navigation

pybam

A simple, 100% python, BAM file reader.

This project has not been code-reviewed, tested, or even run on more than a handful of BAM files - however if we can get it to work reliably, it would make incorporating BAM file reading into python much simpler since there are no external dependencies to install/compile. Furthermore, initial results show it's pretty fast -- aproaching 2x faster than pysam, although this is most likely because decompression of the BAM files can be done in parallel on pybam (via pigz), utilizing multiple processors. This project is not intended to replace pysam, htspython or simplesam though! Those are all fully-fledged projects with great programmers behind them. pybam is really there to act as a simple way to incorporate BAM-reading into code for other python programmers, since you can literally just copy-paste this module into your own code and be 100% free of dependencies, version incompatibilities, checks to see if users have pysam/htspython/simplesam installed, etc etc. It is simply just here to provide python programmers a more direct level of access to the BAM data than they previously had before.

Using pybam

tl;dr:

    >>> import pybam
    >>> parser = pybam.compile_parser(['seq','qname'])
    >>> for read in parser(pybam.bgunzip('./ENCFF001LCU.bam')):
    ...     print read
    ...
    ('AAAGTTTTTCTGCTTGGGGAAGAAGTTGCCCAGTAT', 'SOLEXA1_0001:4:9:2551:12816#0')
    ('AGTTTTTCTGCTTGGGGAAGAAGTTGCCCAGTATGA', 'SOLEXA1_0001:4:28:12371:18201#0')
    ('GTTTTTCTGCTTGGGGAAGAAGTTGCCCAGTATGAC', 'SOLEXA1_0001:4:10:9456:17693#0')
    ('GTTTTTCTGCTTGGGGAAGAAGTTGCCCAGTATGAC', 'SOLEXA1_0001:4:14:1160:1905#0')
    ('GTTTTTCTGCTTGGGGAAGAAGTTGCCCAGTATGAC', 'SOLEXA1_0001:4:3:12593:7870#0')
    ('GTTTTTCTGCTTGGGGAAGAAGTTGCCCAGTATGAC', 'SOLEXA1_0001:4:72:1174:16008#0')
    ('GTTTTTCTGCTTGGGGAAGAAGTTGCCCAGTATGAC', 'SOLEXA1_0001:4:72:16064:16696#0')
    ('GTTTTTCTGCTTGGGGAAGAAGTTGCCCAGTATGAC', 'SOLEXA1_0001:4:72:6804:8913#0')
    ('GTTTTTCTGCTTGGGGAAGAAGTTGCCCAGTATGAC', 'SOLEXA1_0001:4:73:14207:10900#0')
    ('GTTTTTCTGCTTGGGGAAGAAGTTGCCCAGTATGAC', 'SOLEXA1_0001:4:77:16154:2520#0')
    ...

bgunzip

Pybam consists of 1 class and 1 function. The class, bgunzip(), will remove the compression from a BAM file (from sys.stdin, an open file handle, or file path as a string), parse out the header information, and become an iterable that, if used, returns large blocks of pure uncompressed BAM data.

    python
    Python 2.7.10 (default, Jul 14 2015, 19:46:27)
    [GCC 4.2.1 Compatible Apple LLVM 6.0 (clang-600.0.39)] on darwin
    Type "help", "copyright", "credits" or "license" for more information.
    >>> import pybam
    >>> pure_bam_data = pybam.bgunzip('./ENCFF001LCU.bam')
    Using gzip!
    >>> pure_bam_data.bytes_read
    655360

So as you can see, we have already read the first 655360 bytes of the BAM file, which is more than enough to parse out the header information. Note that this is bytes read of the compressed BAM file, not decompressed bytes. The .bytes_read value will automatically increase as we iterate the BAM file. You can use this if you know the size of the BAM file in advance to make pretty progress bars.

    >>> print pure_bam_data.header_text
    @SQ	SN:chr1	LN:197195432	AS:mm9	SP:mouse
    @SQ	SN:chr2	LN:181748087	AS:mm9	SP:mouse
    @SQ	SN:chr3	LN:159599783	AS:mm9	SP:mouse
    @SQ	SN:chr4	LN:155630120	AS:mm9	SP:mouse
    @SQ	SN:chr5	LN:152537259	AS:mm9	SP:mouse
    @SQ	SN:chr6	LN:149517037	AS:mm9	SP:mouse
    @SQ	SN:chr7	LN:152524553	AS:mm9	SP:mouse
    @SQ	SN:chr8	LN:131738871	AS:mm9	SP:mouse
    @SQ	SN:chr9	LN:124076172	AS:mm9	SP:mouse
    @SQ	SN:chr10	LN:129993255	AS:mm9	SP:mouse
    @SQ	SN:chr11	LN:121843856	AS:mm9	SP:mouse
    @SQ	SN:chr12	LN:121257530	AS:mm9	SP:mouse
    @SQ	SN:chr13	LN:120284312	AS:mm9	SP:mouse
    @SQ	SN:chr14	LN:125194864	AS:mm9	SP:mouse
    @SQ	SN:chr15	LN:103494974	AS:mm9	SP:mouse
    @SQ	SN:chr16	LN:98319150	AS:mm9	SP:mouse
    @SQ	SN:chr17	LN:95272651	AS:mm9	SP:mouse
    @SQ	SN:chr18	LN:90772031	AS:mm9	SP:mouse
    @SQ	SN:chr19	LN:61342430	AS:mm9	SP:mouse
    @SQ	SN:chrX	LN:166650296	AS:mm9	SP:mouse
    @SQ	SN:chrY	LN:15902555	AS:mm9	SP:mouse
    >>>

This is the ASCII portion of the BAM header. On Page 13 of the SAM spec (https://samtools.github.io/hts-specs/SAMv1.pdf) that would be the third row called 'text'.

    >>> print pure_bam_data.chromosomes_from_header
    ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chrX', 'chrY']

This is literally just a parsing of the above ASCII text, from 'SN:' to 'LN:', to get the chromosome names in the order they appear in the header.

    >>> print pure_bam_data.chromosome_names
    ['chr1', 'chr2', 'chr3', 'chr4', 'chr5', 'chr6', 'chr7', 'chr8', 'chr9', 'chr10', 'chr11', 'chr12', 'chr13', 'chr14', 'chr15', 'chr16', 'chr17', 'chr18', 'chr19', 'chrX', 'chrY']

Here the data for the chromosome names comes from the binary portion of the BAM header - called "name" in the SAM spec on row 6. Of course it should match the names and orders of the chromosomes in the ASCII portion of the header, but theres no need for it to, and samtools will do no checking to make sure that is the case. Since pybam originally comes from another (unpublished) project that lets you reorder/remaster BAM file headers on-the-fly, pybam will always check these two are the same, and if they're not, report an error.

    >>> print pure_bam_data.chromosome_lengths
    [197195432, 181748087, 159599783, 155630120, 152537259, 149517037, 152524553, 131738871, 124076172, 129993255, 121843856, 121257530, 120284312, 125194864, 103494974, 98319150, 95272651, 90772031, 61342430, 166650296, 15902555]

This data is also from the binary portion of the header, called l_ref in the SAM spec on row 7. You could parse it out of the ASCII header to see if it matches up too, but currently that isnt done.

    >>> print pure_bam_data.original_binary_header[:3]
    BAM

.original_binary_header is the byte-for-byte BAM header, right up until the first byte of the first read. Above I have only printed the first 3 characters, which for a valid BAM file should always be "BAM". The rest of the header is a mix of ASCII and unprintable binary. You can write this out to disk if you want to make a new valid BAM file header, but with some other read data in the file.

Now we can iterate this class and get back pure, decompressed BAM data, starting from the first read in the file, until the last read in the file:

    >>> for counter,data in enumerate(pure_bam_data):
    ...     print len(data),repr(data[0:20])
    ...     if counter == 10: break
    ...
    654199 '\x92\x00\x00\x00\x00\x00\x00\x00\xa6\xc9-\x00 \x00\x00\x13\x01\x00\x00\x00'
    35536 '\x00\x00\xff\xff\xff\xff\xff\xff\xff\xff\x00\x00\x00\x00SOLEXA'
    35536 '\x11\x11\x11\x11\x11\x11\x02\x02\x02\x02\x02\x02\x02\x02\x02\x02\x02\x02\x02\x02'
    35536 'AAD\x12""""""""""""""""'
    35536 '""""""""""NMC\x01NHC\x01\x81\x00'
    35536 '"""""""""""""""""""N'
    35536 '\x00\x00\xff\xff\xff\xff\xff\xff\xff\xff\x00\x00\x00\x00SOLEXA'
    35536 '\xba\x13\x01\x00\x10\x00$\x00\x00\x00\xff\xff\xff\xff\xff\xff\xff\xff\x00\x00'
    35536 '\x1f\x1f!!\x1f\x1f\x14\x0e\x13 \x02\x02\x02\x02\x02\x02\x02\x02NM'
    35536 '292:6261#0\x00@\x02\x00\x00\x88\x88\x88\x88\x88'
    35536 '\x00@\x02\x00\x00\x88\x88\x88\x88\x88\x88\x88\x82\x11\x11\x11\x11\x11\x11\x11'

As you can see, this data is pretty meaningless unless parsed from BAM to SAM. That will be done by the next part of pybam - the compile_parser(). But there is one final point to mention here for bgunzip. The way BAM files are compressed but still randomly readable is that they are compressed into small chunks called bgzf blocks. The bgzf blocks may have no relation to where reads start and end, so do not rely on bgunzip to give you data which begins at the beginning of a read and ends at the end of a read (except, of course, for the first block which always begins at the beginning of the first read). Expect all the other chunks of decompressed data to contain partial-read data at their start and end. bgunzip has a blocks_at_a_time optional property which you can use to request X bgzf blocks instead of the default of 50 - however this only works if bgunzip does NOT use your local gzip or pigz binary to do the decompression (because then it wont see the blocks at all). If bgunzip IS using gzip or pigz, it will default to reading 35536 bytes from their stdout at a time (which is what we're seeing above). There is no significance in the number 35536, and its likely to change to a more aesthetically pleasing number in the near future.

compile_parser

Now things get a little more interesting :)

There are 11 required fields/columns in a BAM file: QNAME, FLAG, RNAME, POS, MAPQ, CIGAR, RNEXT, PNEXT, TLEN, SEQ, QUAL -- and a optional number of TAGs. Obviously, the more of this data we want to convert from binary BAM to readable SAM, the more work we're going to have to do. On all occassions that i've wanted to read a BAM file, I want to read the same columns of data for every single read in the file (for filtering, calculating some statistic, etc), and so I'd like to be able to tell my parser what it should convert to SAM, and what it should just skip over. We do exactly this by running compile_parser() with a list/tuple of strings that tell it what to grab, and what to convert.

I have not settled on a good naming schema for the parser yet, so it may change in the future. Right now these are the following options:

    block_size   : A BAM-specific thing. Number of bytes in the read, -4 because block_size itself takes up 4 bytes.
    refID        : Chromosome names aren't stored for every read in BAM (because they can be very long ASCII which wastes space). Instead refID is used, which is a number that can be used to look up the chromosome name from the chromosome list (from the header) 
    pos          : This is the same as the SAM value, except its 0-based not 1-based. I have no idea why. Since pybam is a BAM reader, you are expected to +1 to your positions yourself - however, this may change in the future if people really just want SAM out.
    l_read_name  : BAM-specific thing. Length of the QNAME +1
    mapq         : Same as SAM.
    bin_         : BAM-specific thing. Somehow gets calculated from the position. In all honesty, i have no idea what it does or why its needed...
    n_cigar_op   : BAM-specific thing. Number of cigar operations used.
    flag         : Same as SAM. Note that this is actually a 16-bit value, even though there are currently only 12 official flag descriptions. That means 4 more are up for grabs! #read_underappreciated #first_in_heart #lactose_intolerant, etc.
    l_seq        : BAM-specific thing. Length of the sequencing.
    next_refID   : Just like refID, but for the next read (ie. mate)
    next_pos     : Just like pos, but for the next read (ie. mate)
    tlen         : Just like SAM
    qname        : The name of the read. Just like SAM. Although it makes me uncomfortable, the NUL byte ('\x00') on the end has also been removed, to make it just like the SAM data.
    cigar        : Parsed to a list of tuples, where the first letter is the CIGAR operation, and the second is the number of bases that have that operation - essentially the same as Pysam/etc.
    seq          : Parsed to give the DNA sequence. Just like SAM, however, if there are an odd number of DNA bases in SEQ, the last letter is a '=', due to padding. Considering removing this.  
    qual         : For every letter of seq there is an associated qual score from 0 to 255. I dont really know how to go from this to a proper phred value yet.
    tags         : A list, in the order they appear in the BAM file, of tag name (2-letter ID), tag type (1-letter encoding a data type), and variable amount of data as determined by the data type. Just like SAM.

We can also get all of that data as it was in the BAM (without any conversion) by appending "_bam" to the end. So for example, for the raw 4-bit encoded seq data, use 'seq_bam'. The exception is 'bin_', which alread has a '_' at the end because 'bin' is a python keyword we dont want to use. For 'bin_' use 'bin_bam'. There will also be some helper functions in the future like 'read' and 'read_bam' to get the whole read's data back without specifying every little thing. This will be useful if you want to parse the file's SAM data, but then write the whole read to disk in BAM format.

So finally, to compile your own parser do something like this:

    >>> my_parser = pybam.compile_parser(['seq','qname'])
    >>>

You can look to see what code my_parser compiled to by looking at pybam.code (although this will likely become my_parser.code in the future):

    >>> print pybam.code

    def parser(data_generator):
        chunk = next(data_generator)
        CtoPy = { 'A':'<c', 'c':'<b', 'C':'<B', 's':'<h', 'S':'<H', 'i':'<i', 'I':'<I' }
        py4py = { 'A':  1,  'c':  1,  'C':  1,  's':  2,  'S':  2,  'i':  4 , 'I':  4  }
        dna = '=ACMGRSVTWYHKDBN'
        cigar_codes = 'MIDNSHP=X'
        from array import array
        from struct import unpack
        p = 0
        while True:
            try:
                while len(chunk) < p+36: chunk = chunk[p:] + next(data_generator); p = 0
                block_size,refID,pos,l_read_name,mapq,bin_,n_cigar_op,flag,l_seq  = unpack('<iiiBBHHHi' ,chunk[p:p+24])
                while len(chunk) < p + 4 + block_size: chunk = chunk[p:] + next(data_generator); p = 0
            except StopIteration: break
            end = p + block_size + 4
            p += 36
            qname = chunk[p:p+l_read_name-1]
            p += l_read_name
            p += n_cigar_op*4
            l_seq_bytes = -((-l_seq)//2)
            seq = ''.join([ dna[bit4 >> 4] + dna[bit4 & 0b1111] for bit4 in array('B', chunk[p:p+l_seq_bytes]) ])
            p = end
            yield seq,qname
    >>>

So now all we have to do is point our new parser to our raw BAM data generator, and we're good to go!

    >>> for data in my_parser(pure_bam_data):
    ...     print data
    ...     break
    ...
    ('TTTTTTTTGTTTGTTTGTTTTTTTTTTCTGTTTCTT', 'SOLEXA1_0001:4:49:11382:21230#0')

Note that the order of the data in the data tuple is the same as the order of the string keywords we gave compile_parser. Soon this is likely to become a named tuple as it probably always should have been.

About

Very simple, pure python, BAM file reader

Resources

Stars

1 star

Watchers

2 watching

Forks

Releases

Packages

Contributors

Languages