mformat

FastA format

The FastA format we used is similar to the NCBI defined FastA format. In the description line, the sequence name is followed by a greater-than sign ('>'). The RNA sequence is followed as a single line. 'T's are treated as 'U's in the sequence. No space characters are allowed in the FastA format and all its derived formats. An example sequence in FastA format is:

>DEMO-partial
GAGCGGAGCCGCGGGCGGGAGGGCGGACGGACCGACUGACGGUAGGGACGGGAGGCGAGCAAGAUGGCGCAGACGCA

FastC format

The FastC format is defined based on FastA format. There is one additional constraints line followed the sequence line, which indicates the structure tendency for each base. An example in FastC format is:

>DEMO-partial
GAGCGGAGCCGCGGGCGGGAGGGCGGACGGACCGACUGACGGUAGGGACGGGAGGCGAGCAAGAUGGCGCAGACGCA
.x.|..x.||.|...|...x...|..x|..x||.x|x.x|..xx...x|...x..|.x.|xx.xx..|.|x.x|.|x

in which '|' means double-strand tendency, 'x' means single-strand tendency and '.' means no tendency.

FastD format

The FastD format is defined based on FastA format. The sequences are followed by its read depths for single- and double-strand positions. The depths are in float and separated by ';'. If data is not available for either single- or double-strand information, a character '+' is used in that line, instead of a series of zeros. An example in FastD format without double-strand information is:

>DEMO-partial
GAGCGGAGCCGCGGGCGGGAGGGCGGACGGACCGACUGACGGUAGGGACGGGAGGCGAGCAAGAUGGCGCAGACGCA
18.0;24.0;23.0;20.0;37.0;12.0;8.0;7.0;10.0;0.0;14.0;32.0;10.0;16.0;0.0;0.0;0.0;2.0;0.0;0.0;5.0;11.0;1.0;2.0;3.0;3.0;0.0;7.0;3.0;0.0;0.0;1.0;0.0;0.0;4.0;0.0;8.0;10.0;11.0;1.0;13.0;1.0;16.0;0.0;7.0;0.0;4.0;2.0;4.0;0.0;5.0;2.0;0.0;1.0;2.0;18.0;33.0;27.0;58.0;9.0;2.0;0.0;6.0;0.0;1.0;6.0;0.0;0.0;0.0;4.0;0.0;0.0;0.0;2.0;0.0;5.0;1.0
+

FastS format

The FastS format is defined based on FastA format. The sequences are followed by a list of structures. Each structure is followed by a score in the end of the line. The score can be any float value, such as the free energy, transcript percentage and transcript abundance. The structure and score are separated by any space characters. The structure is presented in dot-bracket notation, in which '()' are used to present conventional pairing, and '[]' are used to present pairing in pseudoknots. An example in FastS format is:

>DEMO-partial
GAGCGGAGCCGCGGGCGGGAGGGCGGACGGACCGACUGACGGUAGGGACGGGAGGCGAGCAAGAUGGCGCAGACGCA
.............(((..(((((((....(((((.....((((((((((.(.((..(((((.....(((....))).    (-12.5)
................((((((((((((((((((.....)))).(((.((((.(((..(((...((((...(((...    (-13.8)

The sequence and structures are not fully shown due to limited space.

Extended FastS (EFastS) format

The EFastS format is an extended FastS format exclusively for genes with multiple isoforms. The sequences of all isoforms are firstly merged by genomic loci to an extended transcript (gene model). Then the all structures are aligned to the extended transcript. The unaligned loci are represented by Hyphens '-'. A demo example in EFastS format is:

>DEMO-partial
GAGCGGAGCCGCGGGCGGGAGGGCGGACGGACCGACUGACGGUAGGGACGGGAGGCGAGCAAGAUGGCGCAGACGCA
.............(((..(((((((--------(.....((((((((((.(.((..(((((.....(((....))).    (-12.5)
................((((((((((((((((((.....)))).(((.((((.(((..--------((...(((...    (-13.8))